Dataset Search

Mitochondrion is generally considered as the most promising subcellular organelle for compartmentalization engineering. Much progress has been made in reconstituting whole metabolic pathways in the mitochondria of yeast to harness the precursor pools (i.e., pyruvate and acetyl-CoA), bypass competing pathways, and minimize transportation limitations. However, only a few mitochondrial targeting sequences (MTSs) have been characterized (i.e., MTS of COX4), limiting the application of compartmentalization engineering for multigene biosynthetic pathways in the mitochondria of yeast. In the present study, based on the mitochondrial proteome, a total of 20 MTSs were cloned and the efficiency of these MTSs in targeting heterologous proteins, including the Escherichia coli FabI and enhanced green fluorescence protein (EGFP) into the mitochondria was evaluated by growth complementation and confocal microscopy. After systematic characterization, six of the well-performed MTSs were chosen for the colocalization of complete biosynthetic pathways into the mitochondria. As proof of concept, the full α-santalene biosynthetic pathway consisting of 10 expression cassettes capable of converting acetyl-coA to α-santalene was compartmentalized into the mitochondria, leading to a 3.7-fold improvement in the production of α-santalene. The newly characterized MTSs should contribute to the expanded metabolic engineering and synthetic biology toolbox for yeast mitochondrial compartmentalization engineering.

This version 2 dataset contains 34 files in total with one (1) additional file, called "Culture-dependent Isolate table with taxonomic determination and sequence data.csv". The remaining files (33) are identical to version 1. The following is the information about the new file and its variables: <b>Culture-dependent Isolate table with taxonomic determination and sequence data.csv</b>: Culture table with assigned taxonomy from NCBI. Single direction sequence for each isolate is include if one could be obtained. Sequence is derived from ITS1F-ITS4 PCR amplicons, with Sanger sequencing in one direction using ITS5. The files contains 20 variables with explanation as below: IsolateNumber : unique number identify each isolate cultured Time: season in which the sample was collected Location: the specific name of the location Habitat: type of habitat : either stream or peatland State: state in the USA in which the specific location is located Incubation_pH ID: pH of the medium during isolation of fungal cultures Genus: phylogenetic genus of the fungal isolates (determined by sequence similarity) Sequence_quality: base call quality of the entire sequence used for blast analysis, if known %_coverage: sequence coverage reported from GenBank %_ID: sequence similarity reported from GenBank Life_style : ecological life style if known Phylum: phylogenetic phylum as indicated by Index Fungorum Subphylum: phylogenetic subphylum as indicated by Index Fungorum Class: phylogenetic class as indicated by Index Fungorum Subclass: phylogenetic subclass as indicated by Index Fungorum Order: phylogenetic order as indicated by Index Fungorum Family: phylogenetic Family as indicated by Index Fungorum ITS5_Sequence: single direction sequence used for sequence similarity match using blastn. Primer ITS5 Fasta: sequence with nomenclature in a fasta format for easy cut and paste into phylogenetic software Note: blank cells mean no data is available or unknown.

Data set of trophic cascade in mesocosms experiments for zooplankton (biomass and body size) and phytoplankton (chlorophyll a concentration) caused by Bluegill as well as zooplankton production in those same treatment groups. Zooplankton were collected by tube sampler and phytoplankton were collected through grab samples.

Data necessary for production of figures presented in "Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models" by Pradhan et al.

Software (Matlab .m files) for the article: Lying in Wait: Modeling the Control of Bacterial Infections via Antibiotic-Induced Proviruses. The files can be used to reproduce the analysis and figures in the article.

This is the dataset used in the Landscape Ecology publication of the same name. This dataset consists of the following files: NWCA_Int_Veg.txt NWCA_Reg_Veg.txt NWCA_Site_Attributes.txt NWCA_Int_Veg.txt is a site and plot by species matrix. Column labeled SITES consists of site IDs. Column labeled Plots consist of Plot ID numbers. All other columns represent species abundances (estimates of percent cover, summed across five plots). NWCA_Reg_Veg.txt is a site by species matrix of species abundances. Column labeled SITES consist of site IDs. All other columns represent species abundances (estimates of percent cover within individual plots). NWCA_Site_Attributes.txt is a matrix of site attributes. Column labeled SITES consist of site IDs. Column labeled AA_CENTER_LAT consist of latitudinal coordinates for the Assessment Area center point in decimal degrees. Column labeled AA_CENTER_LONG consist of longitudinal coordinates for the Assessment Area center point in decimal degrees. Column REFPLUS_NWCA represents disturbance gradient classes including MIN (minimally disturbed), L (least disturbed), I (intermediate), M (most disturbed). Column REFPLUS_NWCA2 represents revised disturbance gradient classes based on protocols described in the article. These revised classes were used for analysis. Column labeled STRESS_HEAVYMETAL represents heavy metal stressor classes, used to ascertain which wetlands were missing soil data. Classes in the STRESS_HEAVYMETAL column include Low, Moderate, High, and Missing. Sites with Missing STRESS_HEAVYMETAL classes were removed from analysis. More information about this dataset: All of the data used in this analysis was gathered from the National Wetlands Condition Assessment. Wetland surveys were conducted from 4/4/2011 to 11/2/2011. The entire National Wetlands Condition Assessment Dataset, which includes 3640 unique taxonomic identities of plants, can be found at: https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"

Nest survival and Fledgling production data for Bell's Vireo and Willow Flycatcher nests.

The Delt_Comb.NEX text file contains the original data used in the phylogenetic analyses of Zahniser & Dietrich, 2013 (European Journal of Taxonomy, 45: 1-211). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first nine lines of the file indicate the file type (Nexus), that 152 taxa were analyzed, that a total of 3971 characters were analyzed, the format of the data, and specification for two symbols used in the dataset. There are four datasets separated into blocks, one each for: 28S rDNA gene, Histone H3 gene, morphology, and insertion/deletion characters scored based on the alignment of the 28S rDNA dataset. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the publication using this dataset. A text file, Delt_morph_char.txt, is available here that states the morphological characters and characters states that were scored in the Delt_Comb.NEX dataset. The original DNA sequence data are available from NCBI GenBank under the accession numbers indicated in publication. Chromatogram files for each sequencing read are available from the first author upon request.

The data set contains Supplemental data sets for the Manuscript entitled "Where are they hiding? Testing the body snatchers hypothesis in pyrophilous fungi." Environmental sampling: Amplification of nuclear DNA regions (ITS1 and ITS2) were completed using the Fluidigm Access Array and the resulting amplicons were sequenced on an Illumina MiSeq v2 platform runs using rapid 2 × 250 nt paired-end reads. Illumina sequencing run amplicons that were size selected into <500nt and >500nt sub-pools, then remixed together <500nt: >500nt by nM concentration in a 1x:3x proportion. All amplification and sequencing steps were performed at the Roy J. Carver Biotechnology Center at the University of Illinois Urbana-Champaign. ITS1 region primers consisted of ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-'3) and ITS2 (5'-GCTGCGTTCTTCATCGATGC-'3). ITS2 region primers consisted of fITS7 (5'-GTGARTCATCGAATCTTTG-'3) and ITS4 (5'-TCCTCCGCTTATTGATATGC-'3). Supplemental files 1 through 5 contain the raw data files. Supplemental 1 is the ITS1 Illumina MiSeq forward reads and Supplemental 2 is the corresponding index files. Supplemental 3 is the ITS2 Illumina MiSeq forward reads and Supplemental 4 is the corresponding index files. Supplemental 5 is the map file needed to process the forward reads and index files in QIIME. Supplemental 6 and 7 contain the resulting QIIME 1.9.1. OTU tables along with UNITE, NCBI, and CONSTAX taxonomic assignments in addition to the representative OTU sequence. Numeric samples within the OTU tables correspond to the following: 1 Brachythecium sp. 2 Usnea cornuta 3 Dicranum sp. 4 Leucodon julaceus 5 Lobaria quercizans 6 Rhizomnium sp. 7 Dicranum sp. 8 Thuidium delicatulum 9 Myelochroa aurulenta 10 Atrichum angustatum 11 Dicranum sp. 12 Hypnum sp. 13 Atrichum angustatum 14 Hypnum sp. 15 Thuidium delicatulum 16 Leucobryum sp. 17 Polytrichum commune 18 Atrichum angustatum 19 Atrichum angustatum 20 Atrichum crispulum 21 Bryaceae 22 Leucobryum sp. 23 Conocephalum conicum 24 Climacium americanum 25 Atrichum angustatum 26 Huperzia serrata 27 Polytrichum commune 28 Diphasiastrum sp. 29 Anomodon attenuatus 30 Bryoandersonia sp. 31 Polytrichum commune 32 Thuidium delicatulum 33 Brachythecium sp. 34 Leucobryum glaucum 35 Bryoandersonia sp. 36 Anomodon attenuatus 37 Pohlia sp. 38 Cinclidium sp. 39 Hylocomium splendens 40 Polytrichum commune 41 negative control 42 Soil 43 Soil 44 Soil 45 Soil 46 Soil 47 Soil If a sample number is not present within the OTU table; either no sequences were obtained or no sequences passed the quality filtering step in QIIME. Supplemental 8 contains the Summary of unique species per location.

Datasets used in the study, "TRACTION: Fast non-parametric improvement of estimated gene trees," accepted at the Workshop on Algorithms in Bioinformatics (WABI) 2019.

This dataset provides files for use in analysis of human land preference across Australasia, and in a localized analysis of land preference in Laos and Vietnam. All files can be imported into ArcGIS for visualization, and re-analyzed using the open source Maxent species distribution modeling program. CSV files contain known human presence sites for model validation. ASC files contain geographically coded environmental data for mean annual temperature and mean annual precipitation during the Last Glacial Maximum, as well as downward slope data. All ASC files are in the WGS 1984 Mercator map projection for visualization in ArcGIS and can be opened as text files in text editors supporting large file sizes.

An online and paper knowledge, attitudes, and practices survey on ticks and tick-borne diseases (TBD) was distributed to farmers in Illinois during summer 2020 to spring 2022 (paper version titled Final Draft Farmer KAP_v.SoftCopy_Revised.docx). These are the raw data associated with that survey and the survey questions used (FarmerTickKAPdata.csv, data dictionary in Data Description.docx). We have added calculated values (columns 286 to end, code for calculation in FarmerKAPvariableCalculation.R), including: the tick knowledge score, TBD knowledge score, and total knowledge score, which are the sum of the total number of correct answers in each category, and score percent, which are the proportion of correct answers in each category.

Bee movement between habitat patches in a naturally fragmented ecosystem depended on species, patch, and matrix variables. Using a mark-recapture methodology in the naturally fragmented Ozark glade ecosystem, we assessed the importance of bee size, nesting biology, the distance between patches (e.g., isolation), and nesting and floral resources in habitat patches and the surrounding matrix on bee movement. This dataset includes seven data files, three R code files, and a QGIS tool. Three of the data files include information collected at the study sites with regard to bees and matrix and patch characteristics. The other four data files are spatial files used to quantify the characteristics of the forest canopy between the study sites and the edge-to-edge distances between the study sites. R code in the R Markdown file recreates the analysis and data presentation for the associated publication. R script files contain processes for calculating some of the explanatory variables used in the analysis. The QGIS tool can be used as the first step to obtaining average values from a raster file where the cells are large relative to the areas of interest (AOI) that you would like to characterize. The second step is contained in one of the aforementioned R scripts. Detected effects included: Larger bees were more likely to move between patches. Bee movement was less likely as the distance between patches increased. However, relatively short distances (~50 m) inhibited movement more than our a priori expectations. Bees were unlikely to move away from home patches with abundant and diverse floral and below-ground nesting resources. When home patches were less resource-rich, bee movement depended on the characteristics of the away patch or the matrix. In these cases, bees were more likely to move to away patches with greater below-ground nesting and floral resources. Matrix habitats with more available floral and below-ground nesting resources appear to impede movement to neighboring patches, potentially because they already provide supplemental resources for bees.

A population genetics study was conducted on three plant taxa in the genus Physaria that are found on the Kaibab Plateau (Arizona, USA). Physaria kingii subsp. kaibabensis is endemic to the Kaibab Plateau, and is of conservation concern because of its rarity, limited range, and potential threats to its long-term persistence. Additionally, the taxon is a candidate for federal protection under the Endangered Species Act. It was not clear how genetically isolated P. k. subsp. kaibabensis was from Physaria kingii subsp. latifolia, which is a widespread subspecies found throughout the southwestern USA, including on the Kaibab Plateau. Additionally, other authors have suggested that P. k. subsp. kaibabensis may hybridize with Physaria arizonica, a different species that is also widespread and found on and off the Kaibab Plateau. We conducted a population genetics study of all three groups to better determine the conservation status of P. k. subsp. kaibabensis. Genetic data are in the form of nuclear DNA microsatellites for 13 loci (all apparently diploid). Additionally, we have included location information for the collection sites. We collected tissue samples from on and off the Kaibab Plateau. The overall findings are shared in a manuscript being submitted for peer-review.

Data were used to analyze patterns in predator-specific nest predation on shrubland birds in Illinois as related to landscape composition at multiple landscape scales. Data were used in a Journal of Applied Ecology research paper of the same name. Data were collected between 2011 and 2014 at sites in east-central and northeastern Illinois, USA as part of a Ph.D. research project on the relationship between avian nest predation and landscape characteristics, and how nest predation affects adult and nestling bird behavior.

This is the published ortholog set derived from whole genome data used for the analysis of members of the B. tabaci complex of whiteflies. It includes the concatenated alignment and individual gene alignments used for analyses (Link to publication: https://www.mdpi.com/1424-2818/11/9/151).

Rubisco activase (Rca) facilitates the release of sugar‐phosphate inhibitors from the active sites of Rubisco and thereby plays a central role in initiating and sustaining Rubisco activation. In Arabidopsis, alternative splicing of a single Rca gene results in two Rca isoforms, Rca‐α and Rca‐β. Redox modulation of Rca‐α regulates the function of Rca‐α and Rca‐β acting together to control Rubisco activation. Although Arabidopsis Rca‐α alone less effectively activates Rubisco in vitro , it is not known how CO2 assimilation and plant growth are impacted. Here, we show that two independent transgenic Arabidopsis lines expressing Rca‐α in the absence of Rca‐β (“Rca‐α only” lines) grew more slowly in various light conditions, especially under low light or fluctuating light intensity, and in a short day photoperiod compared to wildtype. Photosynthetic induction was slower in the Rca‐α only lines, and they maintained a lower rate of CO2 assimilation during both photoperiod types. Our findings suggest Rca oligomers composed of Rca‐α only are less effective in initiating and sustaining the activation of Rubisco than when Rca‐β is also present. Currently there are no examples of any plant species that naturally express Rca‐α only but numerous examples of species expressing Rca‐β only. That Rca‐α exists in most plant species, including many C3 and C4 food and bioenergy crops, implies its presence is adaptive under some circumstances.

Sweet sorghum is typically cultivated for the food and fodder market. Recently, sweet sorghum varieties are being metabolically transitioned to enhance energy density by accumulating oil droplets in their vegetative tissues for bioenergy applications. Owing to the high biomass yield of sorghum, the transgenic lines can compete with oil-seed crops for biodiesel yield per unit area. In the initial phase of transgenic development, a high-throughput phenotyping method can bridge the gap between the production pipeline and analysis to improve the efficiency of the process. To meet the requirement, the present study extends the application of time-domain 1H-NMR spectroscopy for rapid quantification and characterization of the total in-situ lipids of sweet sorghum ‘ramada’ to lay the groundwork for analyzing the upcoming large quantity of transgenic samples. NMR technology has been successfully established for analyzing lipid contents of vegetative tissues of non-transgenic variety. The multiexponential analysis of spin-lattice (T1) relaxation spectra obtained from TD-NMR aided the investigation of the dynamics of the free and bound lipid fraction with plant development. The total lipid concentration of bagasse and leaves of non-transgenic sweet sorghum remained unchanged throughout the plant development. Leaves displayed a higher percentage of bound lipids as compared to bagasse. A significant variation in the lipid concentration of juice was observed at the different growth stages with a maximum lipid accumulation of 1.21 ± 0.04% w/w at the boot stage that decreased with further maturity of the plant.

These datasets were performed to assess whether color pattern phenotypes of the polymorphic tortoise beetle, Chelymorpha alternans, mate randomly with one another, and whether there are any reproductive differences between assortative and disassortative pairings.

This repository contains datasets and R scripts that were used in a study of the population structure of Miscanthus sacchariflorus in its native range across East Asia. Notably, genotypes of 764 individuals at 34,605 SNPs, called from reduced-representation DNA sequencing using a non-reference bioinformatics pipeline, are provided. Two similar SNP datasets, used for identifying clonal duplicates and for determining the ancestry of ornamental and hybrid Miscanthus plants identified in previous studies respectively, are also provided. There is also a spreadsheet listing the provenance and ploidy of all individuals along with their plastid (chloroplast) haplotypes. Software output for Structure, Treemix, and DIYABC is also included. See README.txt for more information about individual files. Results of this study are described in a manuscript in revision in Annals of Botany by the same authors, "Population structure of Miscanthus sacchariflorus reveals two major polyploidization events, tetraploid-mediated unidirectional introgression from diploid Miscanthus sinensis, and diversity centered around the Yellow Sea."

The files are plain text and contain the original data used in phylogenetic analyses of of Typhlocybinae (Bin, Dietrich, Yu, Meng, Dai and Yang 2022: Ecology & Evolution, in press). The three files with extension .phy are text files with aligned DNA sequences in the standard PHYLIP format and correspond to Matrix 1 (amino acid alignment), Matrix 2 (nucleotide alignment of first two codon positions of protein-coding genes) and Matrix 3 (nucleotide alignment of protein-coding genes plus 2 ribosomal genes) described in the Methods section. An additional text file in NEXUS format (.nex extension) contains the morphological character data used in the ancestral state reconstruction (ASCR) analysis described in the Methods. NEXUS is a standard format used by various phylogenetic analysis software. For more information on data file content, see the included "readme" files.

The leaf economics spectrum (LES) describes multivariate correlations in leaf structural, physiological and chemical traits, originally based on diverse C3 species grown under natural ecosystems. However, the specific contribution of C4 species to the global LES is studied less widely. C4 species have a CO2 concentrating mechanism which drives high rates of photosynthesis and improves resource use efficiency, thus potentially pushing them towards the edge of the LES. Here, we measured foliage morphology, structure, photosynthesis, and nutrient content for hundreds of genotypes of the C4 grass Miscanthus × giganteus grown in two common gardens over two seasons. We show substantial trait variations across M. × giganteus genotypes and robust genotypic trait relationships. Compared to the global LES, M. × giganteus genotypes had higher photosynthetic rates, lower stomatal conductance, and less nitrogen content, indicating greater water and photosynthetic nitrogen use efficiency in the C4 species. Additionally, tetraploid genotypes produced thicker leaves with greater leaf mass per area and lower leaf density than triploid genotypes. By expanding the LES relationships across C3 species to include C4 crops, these findings highlight that M. × giganteus occupies the boundary of the global LES and suggest the potential for ploidy to alter LES traits.