Illinois Data Bank Dataset Search Results
Results
published:
2019-12-03
These are the alignments of transcriptome data used for the analysis of members of Heteroptera. This dataset is analyzed in "Deep instability in the phylogenetic backbone of Heteroptera is only partly overcome by transcriptome-based phylogenomics" published in Insect Systematics and Diversity.
keywords:
Heteroptera; Hemiptera; Phylogenomics; transcriptome
published:
2021-11-23
Riemer, Nicole; Yao, Yu; Dawson, Matthew; Dabdub, Donald
(2021)
This dataset contains simulation results from PartMC-MOSAIC-CAPRAM used in the article ”Eval- uating the impacts of cloud processing on resuspended aerosol particles after cloud evaporation using a particle-resolved model”.
In this V2, there are eight folders: one for urban plume simulation to provide the initial particle population for cloud processing, the other four folders are for the four cloud cycles simulated and the last two are for the coagulation cases. Within the urban plume simulation, there are 25 NetCDF files hourly output from PartMC-MOSAIC simulations containing the gas and particle information. Within the four cloud cycle folders, there are 25 subdirectories that contain the cloud processing results for aerosol population from urban plume environment. For each subdirectory, there are 31 NetCDF files out- put every minute from PartMC-MOSAIC-CAPRAM simulations containing aerosol and gas information after aqueous chemistry. Another two folders are for the cases considering Brownian coagulation and sedimentation coalescence. Each contained 93 NetCDF files, produced from repeating the 30-minutes simulations for three times to consider the coagulation randomness. The low polluted case folder includes the simulated cloud processing results for 25 urban plume cases with less aerosol number concentration. This dataset was used to investigate the effects of cloud processing on aerosol mixing state and CCN properties.
keywords:
cloud process; coagulation; aqueous chemistry; aerosol mixing state; CCN
published:
2023-03-27
Littlefield, Alexander; Xie, Dajie; Richards, Corey; Ocier, Christian; Gao, Haibo; Messinger, Jonah; Ju, Lawrence; Gao, Jingxing; Edwards, Lonna; Braun, Paul; Goddard, Lynford
(2023)
This dataset contains the full data used in the paper titled "Enabling High Precision Gradient Index Control in Subsurface Multiphoton Lithography," available at https://doi.org/10.1021/acsphotonics.2c01950 .
The data used for Table 1 can be found in the dataset for the related Figure 8.
Some supplemental figures' data can be found in the main figures data:
Figure S2's data is contained in Figure 6.
Figure S4 and Table S1 data is derived from Figure 6.
Figure S9 is derived from Figure 7.
Figure S10 is contained in Figure 7.
Figure S12 is derived from Figure 6 and the Python code prism-fringe-analysis.
Figures without a data file named after them do not have any data affiliated with them and are purely graphical representations.
published:
2020-10-20
Romero, Ingrid; Urban, Michael A.; Punyasena, Surangi
(2020)
This dataset includes a total of 501 images of 42 fossil specimens of Striatopollis and 459 specimens of 45 extant species of the tribe Amherstieae-Fabaceae. These images were taken using Airyscan confocal superresolution microscopy at 630X magnification (63x/NA 1.4 oil DIC). The images are in the CZI file format. They can be opened using Zeiss propriety software (Zen, Zen lite) or in ImageJ. More information on how to open CZI files can be found here: [https://www.zeiss.com/microscopy/us/products/microscope-software/zen/czi.html#microscope---image-data].
keywords:
Striatopollis catatumbus; superresolution microscopy; Cenozoic; tropics; Zeiss; CZI; striate pollen.
published:
2019-10-18
Supporting secondary data used in a manuscript currently in submission regarding the invasion dynamics of the asian tiger mosquito, Aedes albopictus, in the state of Illinois
keywords:
albopictus;mosquito
published:
2021-02-18
Wang, Shaowen; Lyu, Fangzheng; Wang, Shaohua; Catlet, Charles; Padmanabhan, Anand; Soltani, Kiumars
(2021)
Increasingly pervasive location-aware sensors interconnected with rapidly advancing wireless network services are motivating the development of near-real-time urban analytics. This development has revealed both tremendous challenges and opportunities for scientific innovation and discovery. However, state-of-the-art urban discovery and innovation are not well equipped to resolve the challenges of such analytics, which in turn limits new research questions from being asked and answered. Specifically, commonly used urban analytics capabilities are typically designed to handle, process, and analyze static datasets that can be treated as map layers and are consequently ill-equipped in (a) resolving the volume and velocity of urban big data; (b) meeting the computing requirements for processing, analyzing, and visualizing these datasets; and (c) providing concurrent online access to such analytics. To tackle these challenges, we have developed a novel cyberGIS framework that includes computationally reproducible approaches to streaming urban analytics. This framework is based on CyberGIS-Jupyter, through integration of cyberGIS and real-time urban sensing, for achieving capabilities that have previously been unavailable toward helping cities solve challenging urban informatics problems.
The files included in this dataset functions as follows:
1) Spatial_interpolation.ipynb is a python based Jupyter notebook that enables users to conduct spatial interpolation with AoT data;
2) Urban_Informatics.ipynb is a Jupyter notebook that helps to explore the AoT dataset;
3) chicago-complete.weekly.2019-09-30-to-2019-10-06.tar includes all the high-frequency urban sensing data from AoT sensors from 2019 September 30th to 2019 October 6th collected in Chicago, US;
4) sensors.csv is a processed dataset including information about the temperature in Chicago, and it is used in Spatial_interpolation.ipynb.
keywords:
CyberGIS; Urban informatics; Array of Things
published:
2025-01-15
Suski, Cory; Hay, Allison
(2025)
Data was generated from acoustic transmitters implanted in tournament caught and non-angled control largemouth bass across multiple seasons. This data was used to quantify post-release movement, behavior, and mortality in response to angling tournaments at different times of year and varying water temperatures.
published:
2019-05-20
Lao, Yuyang; Schiffer, Peter
(2019)
This is the experimental data of tetris artificial spin ice. The islands are made of Permalloy materials with size of 170 nm by 470 nm by 2.5 nm. The systems are measured at a temperature where the islands are fluctuating around room temperature. The data is recorded as photoemission electron microscopy intensity. More details about the dataset can be found in the file Note.txt and Tetris_data_list.xlsx
Note:
2 files name bl11_teris600_033 and bl11_tetris600_2_135 are not recorded in the excel sheet because they are corrupted during the measurement. Any data that is not recorded in the excel sheet is either corrupted or of low quality.
From files *_028 to *_049, tetris is spelled with “t” while in the raw data folder without “t”. This is a typo. Throughout the dataset, tetris and teris are supposed to have the same meaning.
keywords:
artificial spin ice
published:
2019-07-08
Krichels, Alexander
(2019)
These files contain the data presented in the manuscript entitles "Iron redox reactions can drive microtopographic variation in upland soil carbon dioxide and nitrous oxide emissions".
keywords:
Iron; redox; carbon dioxide; nitrous oxide; chemodenitrification; Feammox; dissimilatory iron reduction; upland soils; flooding; global change
published:
2020-10-15
Khanna, Madhu; Wang, Weiwei; Wang, Michael
(2020)
This dataset consists of various input data that are used in the GAMS model. All the data are in the format of .inc which can be read within GAMS or Notepad. Main data sources include: acreage data (acre), crop budget data ($/acre), crop yield data (e.g. bushel/acre), Soil carbon sequestration data (KgCO2/ha/yr). Model details can be found in the "Assessing the Additional Carbon Savings with Biofuel" and GAMS model package.
## File Description
(1) GAMS Model.zip: This includes all the input files and scripts for running the model
(2) Table*.csv: These files include the data from the tables in the manuscript
(3) Figure2_3_4.csv: This contains the data used to create the figures in the manuscript
(4) BaselineResults.csv: This includes a summary of the model results.
(5) SensitivityResults_*.csv: Model results from the various sensitivity analyses performed
(6) LUC_emission.csv: land use change emissions by crop reporting district for changes of pasturelands to annual crops.
keywords:
Biogenic carbon intensity; Corn ethanol; Economic model; Dynamic optimization; Anticipated baseline approach; Life cycle carbon intenisty
published:
2022-02-11
Hoang, Khanh Linh; Schneider, Jodi; Kansara, Yogeshwar
(2022)
The data contains a list of articles given low score by the RCT Tagger and an error analysis of them, which were used in a project associated with the manuscript "Evaluation of publication type tagging as a strategy to screen randomized controlled trial articles in preparing systematic reviews".
Change made in this V3 is that the data is divided into two parts:
- Error Analysis of 44 Low Scoring Articles with MEDLINE RCT Publication Type.
- Error Analysis of 244 Low Scoring Articles without MEDLINE RCT Publication Type.
keywords:
Cochrane reviews; automation; randomized controlled trial; RCT; systematic reviews
published:
2019-08-05
Skinner, Rachel; Dietrich, Christopher; Walden, Kimberly; Gordon, Eric; Sweet, Andrew; Podsiadlowski, Lars; Petersen, Malte; Simon, Chris; Takiya, Daniela; Johnson, Kevin
(2019)
The data in this directory corresponds to:
Skinner, R.K., Dietrich, C.H., Walden, K.K.O., Gordon, E., Sweet, A.D., Podsiadlowski, L., Petersen, M., Simon, C., Takiya, D.M., and Johnson, K.P.
Phylogenomics of Auchenorrhyncha (Insecta: Hemiptera) using Transcriptomes: Examining Controversial Relationships via Degeneracy Coding and Interrogation of Gene Conflict.
Systematic Entomology.
Correspondance should be directed to: Rachel K. Skinner, rskinn2@illinois.edu
If you use these data, please cite our paper in Systematic Entomology.
The following files can be found in this dataset:
Amino_acid_concatenated_alignment.phy: the amino acid alignment used in this analysis in phylip format.
Amino_acid_raxml_partitions.txt (for reference only): the partitions for the amino acid alignment, but a partitioned amino acid analysis was not performed in this study.
Amino_acid_concatenated_tree.newick: the best maximum likelihood tree with bootstrap values in newick format.
ASTRAL_input_gene_trees.tre: the concatenated gene tree input file for ASTRAL
README_pie_charts.md: explains the the scripts and data needed to recreate the pie charts figure from our paper. There is also another
Corresponds to the following files:
ASTRAL_species_tree_EN_only.newick: the species tree with only effective number (EN) annotation
ASTRAL_species_tree_pp1_only.newick: the species tree with only the posterior probability 1 (main topology) annotation
ASTRAL_species_tree_q1_only.newick: the species tree with only the quartet scores for the main topology (q1)
ASTRAL_species_tree_q2_only.newick: the species tree with only the quartet scores for the first alternative topology (q2)
ASTRAL_species_tree_q3_only.newick: the species tree with only the quartet scores for the second alternative topology (q3)
print_node_key_files.py: script needed to create the following files:
node_keys.key: text file with node IDs and topologies
complete_q_scores.key: text file with node IDs multiplied q scores
EN_node_vals.key: text file with node IDs and EN values
create_pie_charts_tree.py: script needed to visualize the tree with pie charts, pp1, and EN values plotted at nodes
ASTRAL_species_tree_full_annotation.newick: the species tree with full annotation from the ASTRAL analysis.
NOTE: It may be more useful to examine individual value files if you want to visualize the tree,
e.g., in figtree, since the full annotations are extensive and can make viewing difficult.
Complete_NT_concatenated_alignment.phy: the nucleotide alignment that includes unmodified third codon positions. The alignment is in phylip format.
Complete_NT_raxml_partitions.txt: the raxml-style partition file of the nucleotide partitions
Complete_NT_concatenated_tree.newick: the best maximum likelihood tree from the concatenated complete analysis NT with bootstrap values in newick format
Complete_NT_partitioned_tree.newick: the best maximum likelihood tree from the partitioned complete NT analysis with bootstrap values in newick format
Degeneracy_coded_nt_concatenated_alignment.phy: the degeneracy coded nucleotide alignment in phylip format
Degeneracy_coded_nt_raxml_partitions.txt: the raxml-style partition file for the degeneracy coded nucleotide alignment
Degeneracy_coded_nt_concatenated_tree.newick: the best maximum likelihood tree from the degeneracy-coded concatenated analysis with bootstrap values in newick format
Degeneracy_coded_nt_partitioned_tree.newick: the best maximum likelihood tree from the degeneracy-coded partitioned analysis with bootstrap values in newick format
count_ingroup_taxa.py: script that counts the number of ingroup and/or outgroup taxa present in an alignment
keywords:
Auchenorrhyncha; Hemiptera; alignment; trees
published:
2020-01-20
Zhang, Jun; Wuebbles, Donald; Kinnison, Douglas; Saiz López, Alfonso
(2020)
This datasets provide basis of our analysis in the paper - Revising the Ozone Depletion Potentials for Short-Lived Chemicals such as CF3I and CH3I. All datasets here are from the model output (CAM4-chem). All the simulations (background and perturbation) were run to steady-state and only the last year outputs used in analysis are archived here.
keywords:
Illinois Data Bank; NetCDF; Ozone Depletion Potential; CF3I and CH3I
published:
2025-10-10
Dong, Chang; Shi, Zhuwei; Huang, Lei; Zhao, Huimin; Xu, Zhinan; Lian, Jiazhang
(2025)
Mitochondrion is generally considered as the most promising subcellular organelle for compartmentalization engineering. Much progress has been made in reconstituting whole metabolic pathways in the mitochondria of yeast to harness the precursor pools (i.e., pyruvate and acetyl-CoA), bypass competing pathways, and minimize transportation limitations. However, only a few mitochondrial targeting sequences (MTSs) have been characterized (i.e., MTS of COX4), limiting the application of compartmentalization engineering for multigene biosynthetic pathways in the mitochondria of yeast. In the present study, based on the mitochondrial proteome, a total of 20 MTSs were cloned and the efficiency of these MTSs in targeting heterologous proteins, including the Escherichia coli FabI and enhanced green fluorescence protein (EGFP) into the mitochondria was evaluated by growth complementation and confocal microscopy. After systematic characterization, six of the well-performed MTSs were chosen for the colocalization of complete biosynthetic pathways into the mitochondria. As proof of concept, the full α-santalene biosynthetic pathway consisting of 10 expression cassettes capable of converting acetyl-coA to α-santalene was compartmentalized into the mitochondria, leading to a 3.7-fold improvement in the production of α-santalene. The newly characterized MTSs should contribute to the expanded metabolic engineering and synthetic biology toolbox for yeast mitochondrial compartmentalization engineering.
keywords:
Conversion;Metabolic Engineering
published:
2020-11-05
Miller, Andrew; Raudabaugh, Daniel
(2020)
This version 2 dataset contains 34 files in total with one (1) additional file, called "Culture-dependent Isolate table with taxonomic determination and sequence data.csv". The remaining files (33) are identical to version 1. The following is the information about the new file and its variables:
<b>Culture-dependent Isolate table with taxonomic determination and sequence data.csv</b>: Culture table with assigned taxonomy from NCBI. Single direction sequence for each isolate is include if one could be obtained. Sequence is derived from ITS1F-ITS4 PCR amplicons, with Sanger sequencing in one direction using ITS5. The files contains 20 variables with explanation as below:
IsolateNumber : unique number identify each isolate cultured
Time: season in which the sample was collected
Location: the specific name of the location
Habitat: type of habitat : either stream or peatland
State: state in the USA in which the specific location is located
Incubation_pH ID: pH of the medium during isolation of fungal cultures
Genus: phylogenetic genus of the fungal isolates (determined by sequence similarity)
Sequence_quality: base call quality of the entire sequence used for blast analysis, if known
%_coverage: sequence coverage reported from GenBank
%_ID: sequence similarity reported from GenBank
Life_style : ecological life style if known
Phylum: phylogenetic phylum as indicated by Index Fungorum
Subphylum: phylogenetic subphylum as indicated by Index Fungorum
Class: phylogenetic class as indicated by Index Fungorum
Subclass: phylogenetic subclass as indicated by Index Fungorum
Order: phylogenetic order as indicated by Index Fungorum
Family: phylogenetic Family as indicated by Index Fungorum
ITS5_Sequence: single direction sequence used for sequence similarity match using blastn. Primer ITS5
Fasta: sequence with nomenclature in a fasta format for easy cut and paste into phylogenetic software
Note: blank cells mean no data is available or unknown.
keywords:
ITS1 forward reads; Illumina; peatlands; streams; bogs; fens
published:
2019-05-07
Detmer, Thomas; Wahl, David
(2019)
Data set of trophic cascade in mesocosms experiments for zooplankton (biomass and body size) and phytoplankton (chlorophyll a concentration) caused by Bluegill as well as zooplankton production in those same treatment groups. Zooplankton were collected by tube sampler and phytoplankton were collected through grab samples.
keywords:
Trophic cascades; size-selective predation; compensatory mechanisms; biomanipulation; invasive fish; Daphnia; Moina
published:
2019-05-10
Pradhan, Dikshant; Jensen, Paul
(2019)
Data necessary for production of figures presented in "Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models" by Pradhan et al.
keywords:
Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models;
published:
2019-07-04
Software (Matlab .m files) for the article: Lying in Wait: Modeling the Control of Bacterial Infections via Antibiotic-Induced Proviruses. The files can be used to reproduce the analysis and figures in the article.
keywords:
Matlab codes; antibiotic-induced dynamics
published:
2020-02-12
Price, Edward; Spyreas, Greg; Matthews, Jeffrey
(2020)
This is the dataset used in the Landscape Ecology publication of the same name. This dataset consists of the following files:
NWCA_Int_Veg.txt
NWCA_Reg_Veg.txt
NWCA_Site_Attributes.txt
NWCA_Int_Veg.txt is a site and plot by species matrix. Column labeled SITES consists of site IDs. Column labeled Plots consist of Plot ID numbers. All other columns represent species abundances (estimates of percent cover, summed across five plots).
NWCA_Reg_Veg.txt is a site by species matrix of species abundances. Column labeled SITES consist of site IDs. All other columns represent species abundances (estimates of percent cover within individual plots).
NWCA_Site_Attributes.txt is a matrix of site attributes. Column labeled SITES consist of site IDs. Column labeled AA_CENTER_LAT consist of latitudinal coordinates for the Assessment Area center point in decimal degrees. Column labeled AA_CENTER_LONG consist of longitudinal coordinates for the Assessment Area center point in decimal degrees. Column REFPLUS_NWCA represents disturbance gradient classes including MIN (minimally disturbed), L (least disturbed), I (intermediate), M (most disturbed). Column REFPLUS_NWCA2 represents revised disturbance gradient classes based on protocols described in the article. These revised classes were used for analysis. Column labeled STRESS_HEAVYMETAL represents heavy metal stressor classes, used to ascertain which wetlands were missing soil data. Classes in the STRESS_HEAVYMETAL column include Low, Moderate, High, and Missing. Sites with Missing STRESS_HEAVYMETAL classes were removed from analysis.
More information about this dataset: All of the data used in this analysis was gathered from the National Wetlands Condition Assessment. Wetland surveys were conducted from 4/4/2011 to 11/2/2011. The entire National Wetlands Condition Assessment Dataset, which includes 3640 unique taxonomic identities of plants, can be found at: https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys
keywords:
Anthropogenic disturbance; β-Diversity; Biotic homogenization; Phalaris arundinacea; reed canary grass; Wetlands
published:
2020-04-22
Endres, A. Bryan; Endres, Renata; Krstinić Nižić, Marinela
(2020)
Data on Croatian restaurant allergen disclosures on restaurant websites, on-line menus and social media comments
keywords:
restaurant; allergen; disclosure; tourism
published:
2024-12-05
Salami, Malik Oyewale; McCumber, Corinne
(2024)
This project investigates retraction indexing agreement among data sources: BCI, BIOABS, CCC, Compendex, Crossref, GEOBASE, MEDLINE, PubMed, Retraction Watch, Scopus, and Web of Science Core. Post-retraction citation may be partly due to authors’ and publishers' challenges in systematically identifying retracted publications. To investigate retraction indexing quality, we investigate the agreement in indexing retracted publications between 11 database sources, restricting to their coverage, resulting in a union list of 85,392 unique items. We also discuss common errors in indexing retracted publications. Our results reveal low retraction indexing agreement scores, indicating that databases widely disagree on indexing retracted publications they cover, leading to a lack of consistency in what publications are identified as retracted. Our findings highlight the need for clear and standard practices in the curation and management of retracted publications.
Pipeline code to get the result files can be found in the GitHub repository
https://github.com/infoqualitylab/retraction-indexing-agreement in the ‘src’ file containing iPython notebooks:
The ‘unionlist_completed-ria_2024-07-09.csv’ file has been redacted to remove proprietary data, as noted below in README.txt. Among our sources, data is openly available only for Crossref, PubMed, and Retraction Watch.
FILE FORMATS:
1) unionlist_completed-ria_2024-07-09.csv - UTF-8 CSV file
2) README.txt - text file
keywords:
retraction status; data quality; indexing; retraction indexing; metadata; meta-science; RISRS
published:
2018-03-01
The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.
File descriptions:
Great_lakes_Map_coordinates.xlsx = coordinates of sample sites
QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed
GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME.
ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME
ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region.
QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed
GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME.
ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME
ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region.
Resulting OTU Table and OTU table with taxonomy
ITS1 Region
wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample.
wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev
ITS2 Region
wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample.
wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev
Rarified illumina dataset for each ITS Region
ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region.
ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region.
Column headings:
#SampleID = code including researcher initials and sequential run number
BarcodeSequence =
LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG
ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC
run_prefix = initials of run operator
Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.
DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)"
Depth_Meters = Depth in meters
Lake = lake name, Michigan or Superior
Nitrogen %
Carbon %
Date = mm/dd/yyyy
pH = acidity, potential of Hydrogen (pH) scale
SampleDescription = Sample or control
X = sequential run number
OTU ID = Operational taxonomic unit ID
keywords:
Illumina; next-generation sequencing; ITS; fungi
published:
2019-05-31
Krichels, Alexander
(2019)
This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"
keywords:
denitrification; depressions; microtopography; nitrous oxide; soil oxygen; soil temperature
published:
2020-02-05
Zahniser, James; Dietrich, Christopher
(2020)
The Delt_Comb.NEX text file contains the original data used in the phylogenetic analyses of Zahniser & Dietrich, 2013 (European Journal of Taxonomy, 45: 1-211). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first nine lines of the file indicate the file type (Nexus), that 152 taxa were analyzed, that a total of 3971 characters were analyzed, the format of the data, and specification for two symbols used in the dataset. There are four datasets separated into blocks, one each for: 28S rDNA gene, Histone H3 gene, morphology, and insertion/deletion characters scored based on the alignment of the 28S rDNA dataset. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the publication using this dataset. A text file, Delt_morph_char.txt, is available here that states the morphological characters and characters states that were scored in the Delt_Comb.NEX dataset. The original DNA sequence data are available from NCBI GenBank under the accession numbers indicated in publication. Chromatogram files for each sequencing read are available from the first author upon request.
keywords:
phylogeny; DNA sequence; morphology; parsimony analysis; Insecta; Hemiptera; Cicadellidae; leafhopper; evolution; 28S rDNA; histone H3; bayesian analysis
published:
2019-02-26
Neumann, Elizabeth; Comi, Troy; Rubakhin, Stanislav; Sweedler, Jonathan
(2019)
We have recently created an approach for high throughput single cell measurements using matrix assisted laser desorption / ionization mass spectrometry (MALDI MS) (J Am Soc Mass Spectrom. 2017, 28, 1919-1928. doi: 10.1007/s13361-017-1704-1. Chemphyschem. 2018, 19, 1180-1191. doi: 10.1002/cphc.201701364). While chemical detail is obtained on individual cells, it has not been possible to correlate the chemical information with canonical cell types.
Now we combine high-throughput single cell mass spectrometry with immunocytochemistry to determine lipid profiles of two known cell types, astrocytes and neurons from the rodent brain, with the work appearing as “Lipid heterogeneity between astrocytes and neurons revealed with single cell MALDI MS supervised by immunocytochemical classification” (DOI: 10.1002/anie.201812892).
Here we provide the data collected for this study. The dataset provides the raw data and script files for the rodent cerebral cells described in the manuscript.
keywords:
Single cell analysis; mass spectrometry; astrocyte; neuron; lipid analysis