Dataset Search Results

Data were used to analyze patterns in predator-specific nest predation on shrubland birds in Illinois as related to landscape composition at multiple landscape scales. Data were used in a Journal of Applied Ecology research paper of the same name. Data were collected between 2011 and 2014 at sites in east-central and northeastern Illinois, USA as part of a Ph.D. research project on the relationship between avian nest predation and landscape characteristics, and how nest predation affects adult and nestling bird behavior.

We developed and delivered in-person training at local health department offices in six of the seven Illinois Department of Public Health “health regions” between April-May of 2019. Pre-, post-, and six-month follow-up questionnaires on knowledge, attitudes, and practices with regards to tick surveillance were administered to training participants.

Dataset includes bee trait information and species abundance information for bees collected at 29 forests plots in southern Illinois, USA. Plots are located within three public land sites. Environmental data were also collected for each of the 29 plots.

Nucleotide sequences from wild parsnip CYP71AJ4 (angelic in synthase. <a href ="https://www.ncbi.nlm.nih.gov/nuccore/EF191021">Genbank EF191021</a>) were obtained by Sanger sequencing. Seeds from individual plants from different populations were harvested to obtain corresponding cDNA. The cDNA was cloned and directly sequenced. Aminoacid translations were obtained using standard codon usage. Alignments of CYP71AJ4 sequences (involved in angular furanocoumarin biosynthesis) with as the reference sequence. Consistent amino acid variabilities were found between some populations. The relationship between sequencing variability and selective pressure is not yet known.

These data were collected in 2018 and 2019 at the University of Illinois Energy Farm (N 40.063607, W 88.206926). During each growing season, bulk and rhizosphere soil were collected from replicate Sorghum bicolor nitrogen use efficiency trial plots at three separate time points (approximately July 1, August 1, and September 1). We measured soil moisture, pH, soil nitrate and ammonium, potential nitrification, potential denitrification, and extracted and sequenced the V4 region of the 16S rRNA gene for microbial community analysis. All microbial sequence data is archived in the National Center for Biotechnology Information’s (NCBI) Sequence Read Archive (accession number SRP326979, project number PRJNA741261).

This dataset was compiled between 2010 and 2011 from data published in the scientific literature from articles evaluating the influence of cropping systems and soil management practices on soil organic Carbon. We used the Thomas Reuter Web of Science database and by reviewed the reference sections of key peer-reviewed articles. Articles included in the database presented results from field sites within the continental United States.

Corbicula spp. are one of the most prolific aquatic invasive species in the world and can have negative effects on aquatic ecosystems. We performed qualitative field surveys, examined literature accounts and natural history museum holdings, and accessed citizen science data sources to document the distribution of Corbicula in Mexico and shared drainages. Through 26 publications (N = 127 records), 312 museum holdings, and 446 iNaturalist records, we documented 885 records pertaining to Corbicula in Mexico and shared drainages. The first record of the species in Mexico was in 1969, and it has since been reported from 26 of the 32 Mexican states and most of the major river basins throughout the country. However, we suggest Corbicula is more prevalent in Mexico than we report in this work as it is often under sampled / under reported.

We conducted long-term capture-mark-recapture surveys on two isolated ornate box turtle (Terrapene ornata) populations in northern Illinois, USA. This dataset provides the capture history strings and additional demographic information used for estimating population vital rates with robust design capture-mark-recapture models. The vital rates were then used in a stage-based population projection matrix model for each population.

Data characterize zooplankton in Shelbyville Reservoir, Illinois, United States of America. Zooplankton were sampled with a conical zooplankton net (0.5m diameter mouth) when water was deeper than 2 m and by grab sample when water was shallower. Zooplankton samples were concentrated and subsampled with a Hensen-Stempel pipette following protocols described in Detmer et al. (2019). Zooplankton were identified to the lowest feasible taxonomic unit according to Pennak (1989) and Thorp and Covich (2001) and were enumerated in a 1 mL Sedgewick-Rafter cell. Subsamples were analyzed until at least 200 individuals were enumerated from each site.were counted across for each of the three main taxonomic groups (cladocerans, copepods, and rotifers). Given the variation in zooplankton concentrations at each site, this process often lead to far more than 200 individuals being counted (x̄ = 269, min = 200, max = 487). A summary of the sample size from each site can be found in Supplementary Table S2. Abundances were corrected for volume of water filtered. For rare taxa (< 20 individuals per sample), all individuals were measured for length. For abundant taxa, length measurements were collected on the first 20 organisms of each abundant taxon encountered in a subsample. Dry mass was calculated from equations for microcrustaceans, rotifers, and Chaoborus sp. (Rosen ,1981; Botrell et al., 1976; Dumont and Balvay, 1979).

Data from an a field survey at Nikko National Park in central Japan. Data contain information about deer carcass, environment of sites, and vertebrate scavenging.

This dataset contains 1 CSV file: RozanskyLarsonTaylorMsat.csv which contains microsatellite fragment lengths for Virile and Spothanded Crayfish from the Current River watershed of Missouri, U.S., and complimentary data, including assignments to species by phenotype and COI sequence data, GenBank accession numbers for COI sequence data, study sites with dates of collection and geographic coordinates, and Illinois Natural History Survey (INHS) Crustacean Collection lots where specimens are stored.

Baseline data from a multi-modal intervention study conducted at the University of Illinois at Urbana-Champaign. Data include results from a cardiorespiratory fitness assessment (maximal oxygen consumption, VO2max), a body composition assessment (Dual-Energy X-ray Absorptiometry, DXA), and Magnetic Resonance Spectroscopy Imaging. Data set includes data from 435 participants, ages 18-44 years.

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

We have recently created an approach for high throughput single cell measurements using matrix assisted laser desorption / ionization mass spectrometry (MALDI MS) (J Am Soc Mass Spectrom. 2017, 28, 1919-1928. doi: 10.1007/s13361-017-1704-1. Chemphyschem. 2018, 19, 1180-1191. doi: 10.1002/cphc.201701364). While chemical detail is obtained on individual cells, it has not been possible to correlate the chemical information with canonical cell types. Now we combine high-throughput single cell mass spectrometry with immunocytochemistry to determine lipid profiles of two known cell types, astrocytes and neurons from the rodent brain, with the work appearing as “Lipid heterogeneity between astrocytes and neurons revealed with single cell MALDI MS supervised by immunocytochemical classification” (DOI: 10.1002/anie.201812892). Here we provide the data collected for this study. The dataset provides the raw data and script files for the rodent cerebral cells described in the manuscript.

This dataset contains all data used in the two studies included in "PICAN-PI..." by Nute, et al, other than the original raw sequences. That includes: 1) Supplementary information for the Manuscript, including all the graphics that were created, 2) 16S Reference Alignment, Phylogeny and Taxonomic Annotation used by SEPP, and 3) Data used in the manuscript as input for the graphics generation (namely, SEPP outputs and sequence multiplicities).

This dataset is provided to support the statements in Tarokh, A., and R.Y. Makhnenko. 2019. Remarks on the solid and bulk responses of fluid-filled porous rock, Geophysics. The unjacketed bulk modulus is a poroelastic parameter that can be directly measured in a laboratory test under a loading that preserves the difference between the mean stress and pore pressure constant. For a monomineralic rock, the measurement of the unjacketed bulk modulus is ignored because it is assumed to be equal to the bulk modulus of the solid phase. To examine this assumption, we tested porous sandstones (Berea and Dunnville) and limestones (Apulian and Indiana) mainly composed of quartz and calcite, respectively, under the unjacketed condition. The presence of microscale inhomogeneities, in the form of non-connected (occluded) pores, was shown to cause a considerable difference between the unjacketed bulk modulus and the bulk modulus of the solid phase. Furthermore, we found the unjacketed bulk modulus to be independent of the unjacketed pressure and Terzaghi effective pressure and therefore a constant.

This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"

Concatenated sequence alignment, phylogenetic analysis files, and relevant software parameter files from a cophylogenetic study of Brueelia-complex lice and their avian hosts. The sequence alignment file includes a list of character blocks for each gene alignment and the parameters used for the MrBayes phylogenetic analysis. 1) Files from the MrBayes analyses: a) a file with 100 random post-burnin trees (50% burnin) used in the cophylogenetic analysis - analysisrandom100_trees_brueelia.tre b) a majority rule consensus tree - treeconsensus_tree_brueelia.tre c) a maximum clade credibility tree - mcc_tree_brueelia.tre The tree tips are labeled with louse voucher names, and can be referenced in Supplementary Table 1 of the associated publication. 2) Files related to a BEAST analysis with COI data: a) the XML file used as input for the BEAST run, including model parameters, MCMC chain length, and priors - beast_parameters_coi_brueelia.xml b) a file with 100 random post-burnin trees (10% burnin) from the BEAST posterior distribution of trees; used in OTU analysis - beast_100random_trees_brueelia.tre c) an ultrametric maximum clade credibility tree - mcc_tree_beast_brueelia.tre 3) A maximum clade credibility tree of Brueelia-complex host species generated from a distribution of trees downloaded from https://birdtree.org/subsets/ - mcc_tree_brueelia_hosts.tre 4) Concatenated sequence alignment - concatenated_alignment_brueelia.nex

GBS data from Phaseolus accessions, for a study led by Dr. Glen Hartman, UIUC. <br />The (zipped) fastq file can be processed with the TASSEL GBS pipeline or other pipelines for SNP calling. The related article has been submitted and the methods section describes the data processing in detail.

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

These data include information on a field experiment on Castilleja coccinea (L.) Spreng., scarlet Indian paintbrush (Orobanchaceae). There is intraspecific variation in scarlet Indian paintbrush in the color of the bracts surrounding the flowers. Two bract color morphs were included in this study, the scarlet and yellow morphs. The experiment was conducted at Illinois Beach State Park in 2012. The aim of the work was to compare the color morphs with regard to 1) self-compatibility, 2) response to pollinator exclusion, 3) cross-compatibility between the color morphs, and 4) relative female fertility and male fitness. Three files are attached with this record. The raw data are in "fruitSet.csv" and "seedSet.csv", while "readme.txt" has detailed explanations of the raw data files.

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

Dataset for F2F events of honeybees. F2F events are defined as face-to-face encounters of two honeybees that are close in distance and facing each other but not connected by the proboscis, thus not engaging in trophallaxis. The first and the second columns show the unique id's of honeybees participating in F2F events. The third column shows the time at which the F2F event started while the fourth column shows the time at which it ended. Each time is in the Unix epoch timestamp in milliseconds.