Dataset Search Results

Please cite as: Jim Miller, Sergiusz Czesny, Qihong Dai, James Ellis, Louis Iverson, Jeff Matthews, Charles Roswell, Cory Suski, John Taft, and Mike Ward. 2021. “Climate Change Impacts on Ecosystems: Scientific and Common Species Names”.

Supplemental Forest Data for Chapter 6: Climate Change Impacts on Ecosystems in "An Assessment of the Impacts of Climate Change in Illinois"

Dataset compiled by Yushu Xia and Michelle Wander for the Soil Health Institute. Data were recovered from peer reviewed literature reporting results for three soil quality indicators (SQIs) (β-glucosidase (BG), fluorescein diacetate (FDA) hydrolysis, and permanganate oxidizable carbon (POXC)) in terms of their relative response to management where soils under grassland cover, no-tillage, cover crops, residue return and organic amendments were compared to conventionally managed controls. Peer-reviewed articles published between January of 1990 and May 2018 were searched using the Thomas Reuters Web of Science database (Thomas Reuters, Philadelphia, Pennsylvania) and Google Scholar to identify studies reporting results for: “β-glucosidase”, “permanganate oxidizable carbon”, “active carbon”, “readily oxidizable carbon”, and “fluorescein diacetate hydrolysis”, together with one or more of the following: “management practice”, “tillage”, “cover crop”, “residue”, “organic fertilizer”, or “manure”. Records were tabulated to compare SQI abundance in soil maintained under a control and soil aggrading practice with the intent to contribute to SQI databases that will support development of interpretive frameworks and/or algorithms including pedo-transfer functions relating indicator abundance to management practices and site specific factors. Meta-data include the following key descriptor variables and covariates useful for development of scoring functions: 1) identifying factors for the study site (location, year of initiation of study and year in which data was reported), 2) soil textural class, pH, and SOC, 3) depth and timing of soil sampling, 4) analytical methods for SQI quantification, 5) units used in published works (i.e. equivalent mass, concentration), 6) SQI abundances, and 7) statistical significance of difference comparisons. *Note: Blank values in tables are considered unreported data.

Raw data and its analysis collected from a trial designed to test the impact of providing a Bacillus-based direct-fed microbial (DFM) on the syndrome resulting from orally infecting pigs with either Salmonella enterica serotype Choleraesuis (S. Choleraesuis) alone, or in combination with an intranasal challenge, three days later, with porcine reproductive and respiratory syndrome virus (PRRSV).

This dataset consists of various input data that are used in the GAMS model. All the data are in the format of .inc which can be read within GAMS or Notepad. Main data sources include: acreage data (acre), crop budget data ($/acre), crop yield data (e.g. bushel/acre), Soil carbon sequestration data (KgCO2/ha/yr). Model details can be found in the "Assessing the Additional Carbon Savings with Biofuel" and GAMS model package. ## File Description (1) GAMS Model.zip: This includes all the input files and scripts for running the model (2) Table*.csv: These files include the data from the tables in the manuscript (3) Figure2_3_4.csv: This contains the data used to create the figures in the manuscript (4) BaselineResults.csv: This includes a summary of the model results. (5) SensitivityResults_*.csv: Model results from the various sensitivity analyses performed (6) LUC_emission.csv: land use change emissions by crop reporting district for changes of pasturelands to annual crops.

Data on permanent plots at Fortuna and the Panama Canal Watershed, Republic of Panama, containing counts and percent of trees with one or more multiple stems >10cm diameter, with and without palms. Accompanying environmental data includes elevation, precipitation, soil type and soil chemical variables (pH, total N, NO3, NO4, resin P, mehlich Ca, K and Mg.

Original leaf gas exchange and absorptance data used in the Collison et al. (2020) Light, Not Age, Underlies the Q9 Maladaptation of Maize and Miscanthus Photosynthesis to Self-Shading - Frontiers in Plant Science doi: 10.3389/fpls.2020.00783

This repository includes scripts and datasets for Chapter 6 of my PhD dissertation, " Supertree-like methods for genome-scale species tree estimation," that had not been published previously. This chapter is based on the article: Molloy, E.K. and Warnow, T. "FastMulRFS: Fast and accurate species tree estimation under generic gene duplication and loss models." Bioinformatics, In press. https://doi.org/10.1093/bioinformatics/btaa444. The results presented in my PhD dissertation differ from those in the Bioinformatics article, because I re-estimated species trees using FastMulRF and MulRF on the same datasets in the original repository (https://doi.org/10.13012/B2IDB-5721322_V1). To re-estimate species trees, (1) a seed was specified when running MulRF, and (2) a different script (specifically preprocess_multrees_v3.py from https://github.com/ekmolloy/fastmulrfs/releases/tag/v1.2.0) was used for preprocessing gene trees (which were then given as input to MulRF and FastMulRFS). Note that this preprocessing script is a re-implementation of the original algorithm for improved speed (a bug fix also was implemented). Finally, it was brought to my attention that the simulation in the Bioinformatics article differs from prior studies, because I scaled the species tree by 10 generations per year (instead of 0.9 years per generation, which is ~1.1 generations per year). I re-simulated datasets (true-trees-with-one-gen-per-year-psize-10000000.tar.gz and true-trees-with-one-gen-per-year-psize-50000000.tar.gz) using 0.9 years per generation to quantify the impact of this parameter change (see my PhD dissertation or the supplementary materials of Bioinformatics article for discussion).

This repository includes scripts and datasets for the paper, "FastMulRFS: Fast and accurate species tree estimation under generic gene duplication and loss models." Note: The results from estimating species trees with ASTRID-multi (included in this repository) are *not* included in the FastMulRFS paper. We estimated species trees with ASTRID-multi in the fall of 2019, but ASTRID-multi had an important bug fix in January 2020. Therefore, the ASTRID-multi species trees in this repository should be ignored.

This data describes habitat use, availability, landscape level influences, and daily movement of dabbling ducks in the Wabash River Valley of southeastern Illinois and southwestern Indiana. It contains triangulated locations of individual ducks, associated habitat assignments of those locations, flood survey data to determine water availability, and randomly generated points to assess landscape level questions.

Dataset associated with Jones et al FE-2019-01175 submission: Does the size and developmental stage of traits at fledging reflect juvenile flight ability among songbirds? Excel CSV files with all of the data used in analyses and file with descriptions of each column. The flight ability variable in this dataset was derived from fledgling drop tests, examples of which can be found in the related dataset: Jones, Todd M.; Benson, Thomas J.; Ward, Michael P. (2019): Flight Ability of Juvenile Songbirds at Fledgling: Examples of Fledgling Drop Tests. University of Illinois at Urbana-Champaign. https://doi.org/10.13012/B2IDB-2044905_V1.

This dataset provides files for use in analysis of human land preference across Australasia, and in a localized analysis of land preference in Laos and Vietnam. All files can be imported into ArcGIS for visualization, and re-analyzed using the open source Maxent species distribution modeling program. CSV files contain known human presence sites for model validation. ASC files contain geographically coded environmental data for mean annual temperature and mean annual precipitation during the Last Glacial Maximum, as well as downward slope data. All ASC files are in the WGS 1984 Mercator map projection for visualization in ArcGIS and can be opened as text files in text editors supporting large file sizes.

The Delt_Comb.NEX text file contains the original data used in the phylogenetic analyses of Zahniser & Dietrich, 2013 (European Journal of Taxonomy, 45: 1-211). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first nine lines of the file indicate the file type (Nexus), that 152 taxa were analyzed, that a total of 3971 characters were analyzed, the format of the data, and specification for two symbols used in the dataset. There are four datasets separated into blocks, one each for: 28S rDNA gene, Histone H3 gene, morphology, and insertion/deletion characters scored based on the alignment of the 28S rDNA dataset. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the publication using this dataset. A text file, Delt_morph_char.txt, is available here that states the morphological characters and characters states that were scored in the Delt_Comb.NEX dataset. The original DNA sequence data are available from NCBI GenBank under the accession numbers indicated in publication. Chromatogram files for each sequencing read are available from the first author upon request.

This is the dataset used in the Landscape Ecology publication of the same name. This dataset consists of the following files: NWCA_Int_Veg.txt NWCA_Reg_Veg.txt NWCA_Site_Attributes.txt NWCA_Int_Veg.txt is a site and plot by species matrix. Column labeled SITES consists of site IDs. Column labeled Plots consist of Plot ID numbers. All other columns represent species abundances (estimates of percent cover, summed across five plots). NWCA_Reg_Veg.txt is a site by species matrix of species abundances. Column labeled SITES consist of site IDs. All other columns represent species abundances (estimates of percent cover within individual plots). NWCA_Site_Attributes.txt is a matrix of site attributes. Column labeled SITES consist of site IDs. Column labeled AA_CENTER_LAT consist of latitudinal coordinates for the Assessment Area center point in decimal degrees. Column labeled AA_CENTER_LONG consist of longitudinal coordinates for the Assessment Area center point in decimal degrees. Column REFPLUS_NWCA represents disturbance gradient classes including MIN (minimally disturbed), L (least disturbed), I (intermediate), M (most disturbed). Column REFPLUS_NWCA2 represents revised disturbance gradient classes based on protocols described in the article. These revised classes were used for analysis. Column labeled STRESS_HEAVYMETAL represents heavy metal stressor classes, used to ascertain which wetlands were missing soil data. Classes in the STRESS_HEAVYMETAL column include Low, Moderate, High, and Missing. Sites with Missing STRESS_HEAVYMETAL classes were removed from analysis. More information about this dataset: All of the data used in this analysis was gathered from the National Wetlands Condition Assessment. Wetland surveys were conducted from 4/4/2011 to 11/2/2011. The entire National Wetlands Condition Assessment Dataset, which includes 3640 unique taxonomic identities of plants, can be found at: https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys

These data were collected for an experiment examining effects of neonicotinoid (clothianidin) presence on hover fly (Diptera: Syrphidae) behavior. Hover flies of two species (Eristalis arbustorum and Toxomerus marginatus) were offered a choice to feed on artificial flowers laced with sucrose solution that was either contaminated (CLO) or not contaminated (CON) with clothianidin. Two different concentrations of clothianidin in 0.5 M sucrose solution were tested: 2.5 ppb and 150 ppb. We conducted four sets of 10 trials, each trial set examining a different combination of species and clothianidin dose. Across 6 hours of video for each trial we recorded 1) number of visits to each flower that resulted in feeding, and 2) amount of time spent feeding during each visit. We found that while neither species fed significantly longer on either of the solutions, E. arbustorum appeared to avoid flowers with clothianidin particularly at high rates. In the paper, we attribute this avoidance response, partially, to hover fly-visible spectral differences between the two flower choices and discuss potential implications for field and lab-based studies. In the enclosed zip file we have included all data for this project and code scripts from R. * Note: Data folder contains 4 files (instead of 6 as mentioned in Readme): e.tenax_photoreceptors.csv; hoverfly_data_UPDATE.csv; number_visits_UPDATE.csv; and Original 2018 hover fly choice test data_Clem2020.xlsx

Baseline data from a multi-modal intervention study conducted at the University of Illinois at Urbana-Champaign. Data include results from a cardiorespiratory fitness assessment (maximal oxygen consumption, VO2max), a body composition assessment (Dual-Energy X-ray Absorptiometry, DXA), and Magnetic Resonance Spectroscopy Imaging. Data set includes data from 435 participants, ages 18-44 years.

VCF files used to analyze a novel filtering tool VEF, presented in the article "VEF: a Variant Filtering tool based on Ensemble methods".

Data sets relating to the manuscript “Long-term yields in annual and perennial bioenergy crops in the Midwestern USA” published in Global Change Biology Bioenergy. Field data, including annual peak biomass and harvest yields from maize/soy, miscanthus, switchgrass, and prairie field trials from 2008-2018 are included. Peak and harvest biomass for fertilized and unfertilized miscanthus are included from 2014-2018.

Data in this publication were used to examine the effects of environmental and temporal covariates on detection probability, and the effects of habitat and landscape level covariates on occupancy and within season turnover of Black-billed Cuckoos and Yellow-billed Cuckoos. Data were collected between 2019-2020 in northern Illinois, USA. Procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 19086.

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

This repository include datasets that are studied with INC/INC-ML/INC-NJ in the paper `Using INC within Divide-and-Conquer Phylogeny Estimation' that was submitted to AICoB 2019. Each dataset has its own readme.txt that further describes the creation process and other parameters/softwares used in making these datasets. The latest implementation of INC/INC-ML/INC-NJ can be found on https://github.com/steven-le-thien/constraint_inc. Note: there may be files with DS_STORE as extension in the datasets; please ignore these files.

The Allan Lab has published a Fluidigm pipeline online. This is the url: https://github.com/HPCBio/allan-fluidigm-pipeline. This url includes a tutorial for running the pipeline. However it does not have test datasets yet. This tarball hosted at the Illinois Data Bank is the dataset that completes the github tutorial. It includes inputs (custom database of tick pathogens and fluidigm raw reads) and output files (tables of samples with taxonomic classifications).

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

Data consists of RNA expression, tuber mass, photosynthetic capacity and diurnal CO2 assimilation calculations, potato tuber nutrient content, photorespiratory metabolite analysis and meteorological data to support the increase in yield and thermotolerance observed in potato plants with an introduce photorespiratory bypass. Data was collected between 2019-2024 at University of Illinois at Urbana-Champaign, IL, USA.

Datasets and R scripts relating to the manuscript "Ecological characteristics and in situ genetic associations for yield-component traits of wild Miscanthus from eastern Russia" published in Annals of Botany, 10.1093/aob/mcw137. Field data, including collection locations, physical and ecological information for each location, and plant phenotypes relating to biomass are included. Genetic data in this repository include single nucleotide polymorphisms (SNPs) derived from restriction site-associated DNA sequencing (RAD-seq), as well as plastid microsatellites. A file is also included listing the DNA sequences of all RAD-seq markers generated to-date by the Sacks lab, including those from this publication.