Dataset Search Results

This repository includes scripts and datasets for the paper, "FastMulRFS: Fast and accurate species tree estimation under generic gene duplication and loss models." Note: The results from estimating species trees with ASTRID-multi (included in this repository) are *not* included in the FastMulRFS paper. We estimated species trees with ASTRID-multi in the fall of 2019, but ASTRID-multi had an important bug fix in January 2020. Therefore, the ASTRID-multi species trees in this repository should be ignored.

This data describes habitat use, availability, landscape level influences, and daily movement of dabbling ducks in the Wabash River Valley of southeastern Illinois and southwestern Indiana. It contains triangulated locations of individual ducks, associated habitat assignments of those locations, flood survey data to determine water availability, and randomly generated points to assess landscape level questions.

Dataset associated with Jones et al FE-2019-01175 submission: Does the size and developmental stage of traits at fledging reflect juvenile flight ability among songbirds? Excel CSV files with all of the data used in analyses and file with descriptions of each column. The flight ability variable in this dataset was derived from fledgling drop tests, examples of which can be found in the related dataset: Jones, Todd M.; Benson, Thomas J.; Ward, Michael P. (2019): Flight Ability of Juvenile Songbirds at Fledgling: Examples of Fledgling Drop Tests. University of Illinois at Urbana-Champaign. https://doi.org/10.13012/B2IDB-2044905_V1.

This dataset provides files for use in analysis of human land preference across Australasia, and in a localized analysis of land preference in Laos and Vietnam. All files can be imported into ArcGIS for visualization, and re-analyzed using the open source Maxent species distribution modeling program. CSV files contain known human presence sites for model validation. ASC files contain geographically coded environmental data for mean annual temperature and mean annual precipitation during the Last Glacial Maximum, as well as downward slope data. All ASC files are in the WGS 1984 Mercator map projection for visualization in ArcGIS and can be opened as text files in text editors supporting large file sizes.

The Delt_Comb.NEX text file contains the original data used in the phylogenetic analyses of Zahniser & Dietrich, 2013 (European Journal of Taxonomy, 45: 1-211). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first nine lines of the file indicate the file type (Nexus), that 152 taxa were analyzed, that a total of 3971 characters were analyzed, the format of the data, and specification for two symbols used in the dataset. There are four datasets separated into blocks, one each for: 28S rDNA gene, Histone H3 gene, morphology, and insertion/deletion characters scored based on the alignment of the 28S rDNA dataset. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the publication using this dataset. A text file, Delt_morph_char.txt, is available here that states the morphological characters and characters states that were scored in the Delt_Comb.NEX dataset. The original DNA sequence data are available from NCBI GenBank under the accession numbers indicated in publication. Chromatogram files for each sequencing read are available from the first author upon request.

This is the dataset used in the Landscape Ecology publication of the same name. This dataset consists of the following files: NWCA_Int_Veg.txt NWCA_Reg_Veg.txt NWCA_Site_Attributes.txt NWCA_Int_Veg.txt is a site and plot by species matrix. Column labeled SITES consists of site IDs. Column labeled Plots consist of Plot ID numbers. All other columns represent species abundances (estimates of percent cover, summed across five plots). NWCA_Reg_Veg.txt is a site by species matrix of species abundances. Column labeled SITES consist of site IDs. All other columns represent species abundances (estimates of percent cover within individual plots). NWCA_Site_Attributes.txt is a matrix of site attributes. Column labeled SITES consist of site IDs. Column labeled AA_CENTER_LAT consist of latitudinal coordinates for the Assessment Area center point in decimal degrees. Column labeled AA_CENTER_LONG consist of longitudinal coordinates for the Assessment Area center point in decimal degrees. Column REFPLUS_NWCA represents disturbance gradient classes including MIN (minimally disturbed), L (least disturbed), I (intermediate), M (most disturbed). Column REFPLUS_NWCA2 represents revised disturbance gradient classes based on protocols described in the article. These revised classes were used for analysis. Column labeled STRESS_HEAVYMETAL represents heavy metal stressor classes, used to ascertain which wetlands were missing soil data. Classes in the STRESS_HEAVYMETAL column include Low, Moderate, High, and Missing. Sites with Missing STRESS_HEAVYMETAL classes were removed from analysis. More information about this dataset: All of the data used in this analysis was gathered from the National Wetlands Condition Assessment. Wetland surveys were conducted from 4/4/2011 to 11/2/2011. The entire National Wetlands Condition Assessment Dataset, which includes 3640 unique taxonomic identities of plants, can be found at: https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys

These data were collected for an experiment examining effects of neonicotinoid (clothianidin) presence on hover fly (Diptera: Syrphidae) behavior. Hover flies of two species (Eristalis arbustorum and Toxomerus marginatus) were offered a choice to feed on artificial flowers laced with sucrose solution that was either contaminated (CLO) or not contaminated (CON) with clothianidin. Two different concentrations of clothianidin in 0.5 M sucrose solution were tested: 2.5 ppb and 150 ppb. We conducted four sets of 10 trials, each trial set examining a different combination of species and clothianidin dose. Across 6 hours of video for each trial we recorded 1) number of visits to each flower that resulted in feeding, and 2) amount of time spent feeding during each visit. We found that while neither species fed significantly longer on either of the solutions, E. arbustorum appeared to avoid flowers with clothianidin particularly at high rates. In the paper, we attribute this avoidance response, partially, to hover fly-visible spectral differences between the two flower choices and discuss potential implications for field and lab-based studies. In the enclosed zip file we have included all data for this project and code scripts from R. * Note: Data folder contains 4 files (instead of 6 as mentioned in Readme): e.tenax_photoreceptors.csv; hoverfly_data_UPDATE.csv; number_visits_UPDATE.csv; and Original 2018 hover fly choice test data_Clem2020.xlsx

Baseline data from a multi-modal intervention study conducted at the University of Illinois at Urbana-Champaign. Data include results from a cardiorespiratory fitness assessment (maximal oxygen consumption, VO2max), a body composition assessment (Dual-Energy X-ray Absorptiometry, DXA), and Magnetic Resonance Spectroscopy Imaging. Data set includes data from 435 participants, ages 18-44 years.

VCF files used to analyze a novel filtering tool VEF, presented in the article "VEF: a Variant Filtering tool based on Ensemble methods".

Data sets relating to the manuscript “Long-term yields in annual and perennial bioenergy crops in the Midwestern USA” published in Global Change Biology Bioenergy. Field data, including annual peak biomass and harvest yields from maize/soy, miscanthus, switchgrass, and prairie field trials from 2008-2018 are included. Peak and harvest biomass for fertilized and unfertilized miscanthus are included from 2014-2018.

Data in this publication were used to examine the effects of environmental and temporal covariates on detection probability, and the effects of habitat and landscape level covariates on occupancy and within season turnover of Black-billed Cuckoos and Yellow-billed Cuckoos. Data were collected between 2019-2020 in northern Illinois, USA. Procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 19086.

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

This repository include datasets that are studied with INC/INC-ML/INC-NJ in the paper `Using INC within Divide-and-Conquer Phylogeny Estimation' that was submitted to AICoB 2019. Each dataset has its own readme.txt that further describes the creation process and other parameters/softwares used in making these datasets. The latest implementation of INC/INC-ML/INC-NJ can be found on https://github.com/steven-le-thien/constraint_inc. Note: there may be files with DS_STORE as extension in the datasets; please ignore these files.

The Allan Lab has published a Fluidigm pipeline online. This is the url: https://github.com/HPCBio/allan-fluidigm-pipeline. This url includes a tutorial for running the pipeline. However it does not have test datasets yet. This tarball hosted at the Illinois Data Bank is the dataset that completes the github tutorial. It includes inputs (custom database of tick pathogens and fluidigm raw reads) and output files (tables of samples with taxonomic classifications).

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

Data consists of RNA expression, tuber mass, photosynthetic capacity and diurnal CO2 assimilation calculations, potato tuber nutrient content, photorespiratory metabolite analysis and meteorological data to support the increase in yield and thermotolerance observed in potato plants with an introduce photorespiratory bypass. Data was collected between 2019-2024 at University of Illinois at Urbana-Champaign, IL, USA.

Datasets and R scripts relating to the manuscript "Ecological characteristics and in situ genetic associations for yield-component traits of wild Miscanthus from eastern Russia" published in Annals of Botany, 10.1093/aob/mcw137. Field data, including collection locations, physical and ecological information for each location, and plant phenotypes relating to biomass are included. Genetic data in this repository include single nucleotide polymorphisms (SNPs) derived from restriction site-associated DNA sequencing (RAD-seq), as well as plastid microsatellites. A file is also included listing the DNA sequences of all RAD-seq markers generated to-date by the Sacks lab, including those from this publication.

This dataset contains: field study design parameters, plant performance metrics, and nitrogen cycling rates associated with a field experiment that compared nitrification rates between maize lines with and without nitrification inhibition loci nitrogen fixation rates with with and without a nitrogen fixing inoculant product. The overarching goal was to evaluate nitrogen fixation by a diazotroph inoculant and retention of nitrogen in the rhizosphere via a novel nitrification inhibition phenotype of maize.

Raw data from a survey of para-veterinary workers in Pakistan regarding knowledge, attitudes, and practices around ticks and tick-borne diseases. Between March and August 2023, we conducted a web-based survey among para-veterinarians recruited via email, text message, and face-to-face conversations.

All data presented in the manuscript published in the Journal of Geophysical Research-Biogeosciences by Stuchiner et al. 2025, "Hot or not? An evaluation of methods for identifying hot moments of nitrous oxide emissions from soils." This includes hourly N2O flux measurements from 20 autochambers from May 2022 to April 2023 in a maize field in central Illinois, and various metrics used to assess hot moments that are evaluated in the manuscript. Note that chamber 5 for each sampling node is sampled from a deep soil collar (50 cm depth) that excludes roots for the purpose of measuring heterotrophic respiration rates.

This dataset is from a study of a simulated angling tournament livewell holding in June of 2023 on Largemouth Bass (Micropterus nigricans) on Clinton Lake, Illinois. Fish were collected via electrofishing, weighed, measured and assessed for physical injury prior to receiving a commercially available cull tag and being placed in a simulated livewell. After a six hour livewell holding period, fish were removed from the livewell assessed for physical injury and then assessed for reflex action mortality predictors prior to being placed in a net pen for 3 days of observation. This dataset includes, weights, total lengths, physical injury scores, and reflex action mortality predictor scores for Largemouth Bass and water quality parameters of livewells and the lake in net pens.

This dataset supports the implementation described in the manuscript "Breaking the Barrier of Human-Annotated Training Data for Machine-Learning-Aided Biological Research Using Aerial Imagery." It comprises UAV aerial imagery used to execute the code available at https://github.com/pixelvar79/GAN-Flowering-Detection-paper. For detailed information on dataset usage and instructions for implementing the code to reproduce the study, please refer to the GitHub repository.

Healthy mares were kept at pasture for 3 weeks, stabled for 5 weeks, returned to pasture and an final sample collected 6 weeks later. Samples were collected weekly: gastric fluid by double-tube nasogastric intubation and aspiration, feces by rectal palpation. Microbial DNA was isolated using the QIAamp PowerFecal Pro DNA kit. Full length 16S, ITS and partial 23S rRNA gene libraries were created using the Shoreline Complete ID kit.

Honey bee (apis mellifera) MERFISH data set prepared by the Han lab, from brains collected by the Robinson lab at UIUC. Dataset is comprised of ~22 thousand cells and 130 genes with x,y locations for each cell. Jupyter notebook file is included as an example to load the data using Scanpy.

School testing data were provided by Shield Illinois (ShieldIL), which conducted weekly in-school testing on behalf of the Illinois Department of Public Health (IDPH) for all participating schools in the state excluding Chicago Public Schools. The populations and proportions of students and employees in the studied school districts are reported by Elementary/Secondary Information System (ElSi) database.