University Library, University of Illinois at Urbana-Champaign

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

This dataset contains genotypic and phenotypic data, R scripts, and the results of analysis pertaining to a multi-location field trial of Miscanthus sinensis. Genome-wide association and genomic prediction were performed for biomass yield and 14 yield-component traits across six field trial locations in Asia and North America, using 46,177 single-nucleotide polymorphism (SNP) markers mined from restriction site-associated DNA sequencing (RAD-seq) and 568 M. sinensis accessions. Genomic regions and candidate genes were identified that can be used for breeding improved varieties of M. sinensis, which in turn will be used to generate new M. xgiganteus clones for biomass.

This data publication provides example video clips related to research on association among flight ability of juvenile songbirds at fledging and juvenile morphological traits (wing emergence, wing length, body condition, mass, and tarsus length. File names reflect the species dropped in each video. These videos are supplemental material for scientific publications by the authors and reflect an example subset of all videos collected form 2017-2018 as part of a larger study on the post-fledging ecology of grassland and shrubland birds in east-Central Illinois, USA. No birds were harmed/injured in the production of these videos and procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 18221. Individuals depicted in the videos have given consent for the videos to be shared (talent/model release form; <a href="https://publicaffairs.illinois.edu/resources/release/">https://publicaffairs.illinois.edu/resources/release/</a>)

Chronic contact exposure to realistic soil concentrations (0, 7.5, 15, and 100 ppb) of the neonicotinoid pesticide imidacloprid had species- and sex-specific effects on bee adult longevity, immature development speed, and mass. This dataset contains a life table tracking the development, mass, and deaths of a single cohort of Osmia lignaria and Megachile rotundata over the course of two summers. Other data files include files created for multi-event survival analysis to analyze the effect on development speed. Detected effects included: decreased adult longevity for female O. lignaria at the highest concentration, a trend for a hormetic effect on female M. rotundata development speed and mass (longest development time and greatest mass in the 15 ppb treatment), and decreased adult longevity and increased development speed at high imidacloprid concentrations as well as a hormetic effect on mass (lowest in the 15 ppb treatment treatment) on male M. rotundata.

This dataset is provided to support the statements in Tarokh, A., and R.Y. Makhnenko. 2019. Remarks on the solid and bulk responses of fluid-filled porous rock, Geophysics. The unjacketed bulk modulus is a poroelastic parameter that can be directly measured in a laboratory test under a loading that preserves the difference between the mean stress and pore pressure constant. For a monomineralic rock, the measurement of the unjacketed bulk modulus is ignored because it is assumed to be equal to the bulk modulus of the solid phase. To examine this assumption, we tested porous sandstones (Berea and Dunnville) and limestones (Apulian and Indiana) mainly composed of quartz and calcite, respectively, under the unjacketed condition. The presence of microscale inhomogeneities, in the form of non-connected (occluded) pores, was shown to cause a considerable difference between the unjacketed bulk modulus and the bulk modulus of the solid phase. Furthermore, we found the unjacketed bulk modulus to be independent of the unjacketed pressure and Terzaghi effective pressure and therefore a constant.

We have recently created an approach for high throughput single cell measurements using matrix assisted laser desorption / ionization mass spectrometry (MALDI MS) (J Am Soc Mass Spectrom. 2017, 28, 1919-1928. doi: 10.1007/s13361-017-1704-1. Chemphyschem. 2018, 19, 1180-1191. doi: 10.1002/cphc.201701364). While chemical detail is obtained on individual cells, it has not been possible to correlate the chemical information with canonical cell types. Now we combine high-throughput single cell mass spectrometry with immunocytochemistry to determine lipid profiles of two known cell types, astrocytes and neurons from the rodent brain, with the work appearing as “Lipid heterogeneity between astrocytes and neurons revealed with single cell MALDI MS supervised by immunocytochemical classification” (DOI: 10.1002/anie.201812892). Here we provide the data collected for this study. The dataset provides the raw data and script files for the rodent cerebral cells described in the manuscript.

The bee visitation data includes the percentage of each bee pollinator group in bee bowls and observed. The data are referenced in the article with the following citation: Bennett, A.B., Lovell, S.T. 2019. Landscape and local site variables differentially influence pollinators and pollination services in urban agricultural sites. Accepted for publication in: PLOS ONE.

Landscape attributes of the nineteen sites as supplemental data for the following article: Bennett, A.B., Lovell, S.T. 2019. Landscape and local site variables differentially influence pollinators and pollination services in urban agricultural sites. Accepted for publication in: PLOS ONE.

This repository include datasets that are studied with INC/INC-ML/INC-NJ in the paper `Using INC within Divide-and-Conquer Phylogeny Estimation' that was submitted to AICoB 2019. Each dataset has its own readme.txt that further describes the creation process and other parameters/softwares used in making these datasets. The latest implementation of INC/INC-ML/INC-NJ can be found on https://github.com/steven-le-thien/constraint_inc. Note: there may be files with DS_STORE as extension in the datasets; please ignore these files.

This dataset contains all data used in the two studies included in "PICAN-PI..." by Nute, et al, other than the original raw sequences. That includes: 1) Supplementary information for the Manuscript, including all the graphics that were created, 2) 16S Reference Alignment, Phylogeny and Taxonomic Annotation used by SEPP, and 3) Data used in the manuscript as input for the graphics generation (namely, SEPP outputs and sequence multiplicities).

This dataset includes data on soil properties, soil N pools, and soil N fluxes presented in the manuscript, "Effects of an invasive perennial forb on gross soil nitrogen cycling and nitrous oxide fluxes," submitted to Ecology for peer-reviewed publication. Please refer to that publication for details about methodologies used to generate these data and for the experimental design.

The text file contains the original data used in the phylogenetic analyses of Wang et al. (2017: Scientific Reports 7:45387). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first six lines of the file identify the file as NEXUS, indicate that the file contains data for 81 taxa (species) and 2905 characters, indicate that the first 2805 characters are DNA sequence and the last 100 are morphological, that the data may be interleaved (with data for one species on multiple rows), that gaps inserted into the DNA sequence alignment are indicated by a dash, and that missing data are indicated by a question mark. The file contains aligned nucleotide sequence data for 5 gene regions and 100 morphological characters. The identity and positions of data partitions are indicated in the mrbayes block of commands for the phylogenetic program MrBayes at the end of the file. The mrbayes block also contains instructions for MrBayes on various non-default settings for that program. These are explained in the original publication. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the supplementary document included as a separate pdf. The original raw DNA sequence data are available from NCBI GenBank under the accession numbers indicated in the supplementary file.

The text file contains the original DNA sequence data used in the phylogenetic analyses of Krishnankutty et al. (2016: Systematic Entomology 41: 580–595). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The file contains five separate data blocks, one for each character partition (28S, histone H3, 12S, indels, and morphology) for 53 taxa (species). Gaps inserted into the DNA sequence alignment are indicated by a dash, and missing data are indicated by a question mark. The separate "indels1" block includes 40 indels (insertions/deletions) from the 28S sequence alignment re-coded using the modified complex indel coding scheme, as described in the "Materials and methods" of the original publication. The DIMENSIONS statements near the beginning of each block indicate the numbers of taxa (NTax) and characters (NChar). The file contains aligned nucleotide sequence data for 3 gene regions and 40 morphological characters. The file is configured for use with the maximum likelihood-based phylogenetic program GARLI but can also be parsed by any other bioinformatics software that supports the NEXUS format. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the supplementary document included as a separate pdf. The original raw DNA sequence data are available from NCBI GenBank under the accession numbers indicated in the supporting pdf file. More details on individual analyses are provided in the original publication.

This is the dataset used in the Ecological Applications publication of the same name. This dataset consists of the following files: Internal.Community.Data.txt Regional.Community.Data.txt Site.Attributes.txt Year.Of.Final.Bio.Monitoring.txt Internal.Community.Data.txt is a site and plot by species matrix. Column labeled SITE consists of site IDs. Column labeled Plot consists of Plot numbers. All other columns represent species relative abundances per plot. Regional.Community.Data.txt is a site by species matrix of relative abundances. Column labeled site consists of site IDs. All other columns represent species relative abundances per site. Site.attributes.txt is a matrix of site attributes. Column labeled SITE consists of site IDs. Column labeled Long represents longitude in decimal degrees. Column labeled Lat represents latitude in decimal degrees. Column labeled Richness represents species richness of sites calculated from Regional Community Data. Column labeled NAT_COMP_REST represents designation as a randomly selected natural wetland (NAT), compensation wetland (COMP) or reference quality natural wetland (REF). Column labeled HQ_LQ_COMP represents designation as high quality (HQ), low quality (LQ) or compensation wetland (COMP). Column labeled SAMPLING_YEAR_INTERNAL represents year data used for analysis of internal β-diversity was gathered. Column labeled SAMPLING_YEAR_REGIONAL represents year data used for analysis of regional β-diversity was gathered. Column labeled TRANSECT_LENGTH represents length in meters of initial sampling transect. INAI_GRADE represents Illinois Natural Areas Inventory grades assigned to each site. Grades range from A for highest quality natural areas to E for lowest quality natural areas. Year.Of.Final.Bio.Monitoring.txt is a table representing years of final monitoring of compensation wetlands as mandated by the US Army Corps of Engineers. Column labeled Site consists of site IDs. Column labeled YR_FIN_BIO_MON consists of years of final monitoring. Entries of N/A represent dates that were unable to be located. More information about this dataset: Interested parties can request data from the Critical Trends Assessment Program, which was the source for data on naturally occurring wetlands in this study. More information on the program and data requests can be obtained by visiting the program webpage. Critical Trends Assessment Program, Illinois Natural History Survey. http://wwx.inhs.illinois.edu/research/ctap/

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

This dataset was compiled between 2010 and 2011 from data published in the scientific literature from articles evaluating the influence of cropping systems and soil management practices on soil organic Carbon. We used the Thomas Reuter Web of Science database and by reviewed the reference sections of key peer-reviewed articles. Articles included in the database presented results from field sites within the continental United States.

This archive contains all the alignments and trees used in the HIPPI paper [1]. The pfam.tar archive contains the PFAM families used to build the HMMs and BLAST databases. The file structure is: ./X/Y/initial.fasttree ./X/Y/initial.fasta where X is a Pfam family, Y is the cross-fold set (0, 1, 2, or 3). Inside the folder are two files, initial.fasta which is the Pfam reference alignment with 1/4 of the seed alignment removed and initial.fasttree, the FastTree-2 ML tree estimated on the initial.fasta. The query.tar archive contains the query sequences for each cross-fold set. The associated query sequences for a cross-fold Y is labeled as query.Y.Z.fas, where Z is the fragment length (1, 0.5, or 0.25). The query files are found in the splits directory. [1] Nguyen, Nam-Phuong D, Mike Nute, Siavash Mirarab, and Tandy Warnow. (2016) HIPPI: Highly Accurate Protein Family Classification with Ensembles of HMMs. To appear in BMC Genomics.

Ammonia flux measurement data using flux gradient and relaxed eddy accumulation methods, and ancillary environmental data collected during the 2014 corn-growing season in Central Illinois, USA. This excel file contains two spreadsheets: one README sheet, and one sheet containing all data. These data were used in the development of the manuscript titled "Ammonia Flux Measurements above a Corn Canopy using Relaxed Eddy Accumulation and a Flux Gradient System."

This dataset contains the protein sequences and trees used to compare NRPS condensation domains in the AMB gene cluster and was used to create figure S1 in Rojas et al. 2015. Instead of having to collect representative sequences independently, this set of condensation domain sequences may serve as a quick reference set for coarse classification of condensation domains.

Supplementary Material for article entitled: "Identifying marginal land for multifunctional perennial cropping systems in the Upper Sangamon River Watershed, Illinois". The material includes the methodology of GIS RUSLE model and details of the suitability analysis variables.

Nucleotide sequences from wild parsnip CYP71AJ4 (angelic in synthase. <a href ="https://www.ncbi.nlm.nih.gov/nuccore/EF191021">Genbank EF191021</a>) were obtained by Sanger sequencing. Seeds from individual plants from different populations were harvested to obtain corresponding cDNA. The cDNA was cloned and directly sequenced. Aminoacid translations were obtained using standard codon usage. Alignments of CYP71AJ4 sequences (involved in angular furanocoumarin biosynthesis) with as the reference sequence. Consistent amino acid variabilities were found between some populations. The relationship between sequencing variability and selective pressure is not yet known.

Weather data used in the survival (mark-recapture) analysis of Swainson's Thrushes crossing the Gulf of Mexico

Data used to estimate the survival of Swainson's Thrushes crossing the Gulf of Mexico.

These data include information on a field experiment on Castilleja coccinea (L.) Spreng., scarlet Indian paintbrush (Orobanchaceae). There is intraspecific variation in scarlet Indian paintbrush in the color of the bracts surrounding the flowers. Two bract color morphs were included in this study, the scarlet and yellow morphs. The experiment was conducted at Illinois Beach State Park in 2012. The aim of the work was to compare the color morphs with regard to 1) self-compatibility, 2) response to pollinator exclusion, 3) cross-compatibility between the color morphs, and 4) relative female fertility and male fitness. Three files are attached with this record. The raw data are in "fruitSet.csv" and "seedSet.csv", while "readme.txt" has detailed explanations of the raw data files.