Displaying datasets 176 - 200 of 254 in total

Subject Area

Life Sciences (254)
Social Sciences (0)
Physical Sciences (0)
Technology and Engineering (0)
Uncategorized (0)
Arts and Humanities (0)

Funder

Other (83)
U.S. National Science Foundation (NSF) (69)
U.S. Department of Energy (DOE) (25)
U.S. Department of Agriculture (USDA) (22)
U.S. National Institutes of Health (NIH) (21)
Illinois Department of Natural Resources (IDNR) (9)
U.S. Geological Survey (USGS) (3)
U.S. National Aeronautics and Space Administration (NASA) (2)
U.S. Army (1)
Illinois Department of Transportation (IDOT) (0)

Publication Year

2021 (66)
2020 (60)
2019 (42)
2022 (31)
2018 (23)
2017 (19)
2016 (12)
2023 (1)

License

CC0 (168)
CC BY (77)
custom (9)
published: 2019-07-29
 
Datasets used in the study, "TRACTION: Fast non-parametric improvement of estimated gene trees," accepted at the Workshop on Algorithms in Bioinformatics (WABI) 2019.
keywords: Gene tree correction; horizontal gene transfer; incomplete lineage sorting
published: 2019-08-15
 
Simulation data related to the paper "Mastitis risk effect on the economic consequences of paratuberculosis control in dairy cattle: A stochastic modeling study"
keywords: paratuberculosis;simulation;dairy
published: 2019-08-13
 
Multiple sequence alignments from concatenated nuclear and mitochondrial genes and resulting phylogenetic tree files of fruit doves and their close relatives. Files include: BEAST input XML file (fruit_dove_beast_input.xml); a maximum clade credibility tree from a BEAST analysis (fruit_dove_beast_mcc.tre); concatenated multiple sequence alignment NEXUS files for the novel dataset (fruit_dove_concatenated_alignment.nex, 76 taxa, 4,277 characters) and the dataset with additional sequences (fruit_dove_plus_cibois_data_concatenated_alignment.nex, 204 taxa, 4,277 characters), both of which contain a MrBayes block including partition information; and 50% majority-rule consensus trees generated from MrBayes analyses, using the NEXUS alignment files as inputs (fruit_dove_mrbayes_consensus.tre, fruit_dove_plus_cibois_data_mrbayes_consensus.tre).
keywords: fruit doves; multiple sequence alignment; phylogeny; Aves: Columbidae
published: 2019-08-30
 
This dataset includes the data from an analysis of bobcat harvest data with particular focus on the relationship between catch-per-unit-effort and population size. The data relate to bobcat trapper and hunter harvest metrics from Wisconsin and include two RDS files which can be open in the software R using the readRDS() function.
keywords: bobcat; catch-per-unit-effort; CPUE; harvest; Lynx rufus; wildlife management; trapper; hunter
published: 2019-08-05
 
The data in this directory corresponds to: Skinner, R.K., Dietrich, C.H., Walden, K.K.O., Gordon, E., Sweet, A.D., Podsiadlowski, L., Petersen, M., Simon, C., Takiya, D.M., and Johnson, K.P. Phylogenomics of Auchenorrhyncha (Insecta: Hemiptera) using Transcriptomes: Examining Controversial Relationships via Degeneracy Coding and Interrogation of Gene Conflict. Systematic Entomology. Correspondance should be directed to: Rachel K. Skinner, rskinn2@illinois.edu If you use these data, please cite our paper in Systematic Entomology. The following files can be found in this dataset: Amino_acid_concatenated_alignment.phy: the amino acid alignment used in this analysis in phylip format. Amino_acid_raxml_partitions.txt (for reference only): the partitions for the amino acid alignment, but a partitioned amino acid analysis was not performed in this study. Amino_acid_concatenated_tree.newick: the best maximum likelihood tree with bootstrap values in newick format. ASTRAL_input_gene_trees.tre: the concatenated gene tree input file for ASTRAL README_pie_charts.md: explains the the scripts and data needed to recreate the pie charts figure from our paper. There is also another Corresponds to the following files: ASTRAL_species_tree_EN_only.newick: the species tree with only effective number (EN) annotation ASTRAL_species_tree_pp1_only.newick: the species tree with only the posterior probability 1 (main topology) annotation ASTRAL_species_tree_q1_only.newick: the species tree with only the quartet scores for the main topology (q1) ASTRAL_species_tree_q2_only.newick: the species tree with only the quartet scores for the first alternative topology (q2) ASTRAL_species_tree_q3_only.newick: the species tree with only the quartet scores for the second alternative topology (q3) print_node_key_files.py: script needed to create the following files: node_keys.key: text file with node IDs and topologies complete_q_scores.key: text file with node IDs multiplied q scores EN_node_vals.key: text file with node IDs and EN values create_pie_charts_tree.py: script needed to visualize the tree with pie charts, pp1, and EN values plotted at nodes ASTRAL_species_tree_full_annotation.newick: the species tree with full annotation from the ASTRAL analysis. NOTE: It may be more useful to examine individual value files if you want to visualize the tree, e.g., in figtree, since the full annotations are extensive and can make viewing difficult. Complete_NT_concatenated_alignment.phy: the nucleotide alignment that includes unmodified third codon positions. The alignment is in phylip format. Complete_NT_raxml_partitions.txt: the raxml-style partition file of the nucleotide partitions Complete_NT_concatenated_tree.newick: the best maximum likelihood tree from the concatenated complete analysis NT with bootstrap values in newick format Complete_NT_partitioned_tree.newick: the best maximum likelihood tree from the partitioned complete NT analysis with bootstrap values in newick format Degeneracy_coded_nt_concatenated_alignment.phy: the degeneracy coded nucleotide alignment in phylip format Degeneracy_coded_nt_raxml_partitions.txt: the raxml-style partition file for the degeneracy coded nucleotide alignment Degeneracy_coded_nt_concatenated_tree.newick: the best maximum likelihood tree from the degeneracy-coded concatenated analysis with bootstrap values in newick format Degeneracy_coded_nt_partitioned_tree.newick: the best maximum likelihood tree from the degeneracy-coded partitioned analysis with bootstrap values in newick format count_ingroup_taxa.py: script that counts the number of ingroup and/or outgroup taxa present in an alignment
keywords: Auchenorrhyncha; Hemiptera; alignment; trees
published: 2019-07-27
 
Genotype calls are provided for a collection of 583 Miscanthus sinensis clones across 1,108,836 loci mapped to version 7 of the Miscanthus sinensis reference genome. Sequence and alignment information for all unique RAD tags is also provided to facilitate cross-referencing to other genomes.
keywords: variant call format (VCF); sequence alignment/map format (SAM); miscanthus; single nucleotide polymorphism (SNP); restriction site-associated DNA sequencing (RAD-seq); bioenergy; grass
published: 2019-07-26
 
Data used in paper published in the Journal of Applied Ecology titled " Bee diversity in tallgrass prairies affected by management and its effects on above- and below-ground resources" Bee Community file contains info on bees sampled in each site. The first column contain the Tallgrass Prairie Sites sampled all additional columns contain the bee species name in the first row and all individuals recorded. Plant Community file contains info on plants sampled in each site. The first column contain the Tallgrass Prairie Sites sampled all additional columns contain the plant species name in the first row and all individuals recorded. Soil PC1 file contains the soil PC1 values used in the analyses. The first column contain the Tallgrass Prairie Sites sampled, the second column contains the calculated soil PC1 values.
keywords: bee; community; tallgrass prairie; grazing
published: 2019-07-11
 
We studied the effect of windstorm disturbance on forest invasive plants in southern Illinois. This data includes raw data on plant abundance at survey points, compiled data used in statistical analyses, and spatial data for surveyed plots and units. This file package also includes a readme.doc file that describes the data in detail, including attribute descriptions.
keywords: tornado, blowdowns, derecho, invasive plants, Shawnee National Forest, southern Illinois
published: 2019-06-22
 
keywords: conspecific attraction; fruit-eating bird; Hawaiian flora; playback experiment; seed dispersal; social information; Zosterops japonicas
published: 2019-07-08
 
These files contain the data presented in the manuscript entitles "Iron redox reactions can drive microtopographic variation in upland soil carbon dioxide and nitrous oxide emissions".
keywords: Iron; redox; carbon dioxide; nitrous oxide; chemodenitrification; Feammox; dissimilatory iron reduction; upland soils; flooding; global change
published: 2019-06-12
 
The data set contains Supplemental data sets for the Manuscript entitled "Where are they hiding? Testing the body snatchers hypothesis in pyrophilous fungi." Environmental sampling: Amplification of nuclear DNA regions (ITS1 and ITS2) were completed using the Fluidigm Access Array and the resulting amplicons were sequenced on an Illumina MiSeq v2 platform runs using rapid 2 × 250 nt paired-end reads. Illumina sequencing run amplicons that were size selected into <500nt and >500nt sub-pools, then remixed together <500nt: >500nt by nM concentration in a 1x:3x proportion. All amplification and sequencing steps were performed at the Roy J. Carver Biotechnology Center at the University of Illinois Urbana-Champaign. ITS1 region primers consisted of ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-'3) and ITS2 (5'-GCTGCGTTCTTCATCGATGC-'3). ITS2 region primers consisted of fITS7 (5'-GTGARTCATCGAATCTTTG-'3) and ITS4 (5'-TCCTCCGCTTATTGATATGC-'3). Supplemental files 1 through 5 contain the raw data files. Supplemental 1 is the ITS1 Illumina MiSeq forward reads and Supplemental 2 is the corresponding index files. Supplemental 3 is the ITS2 Illumina MiSeq forward reads and Supplemental 4 is the corresponding index files. Supplemental 5 is the map file needed to process the forward reads and index files in QIIME. Supplemental 6 and 7 contain the resulting QIIME 1.9.1. OTU tables along with UNITE, NCBI, and CONSTAX taxonomic assignments in addition to the representative OTU sequence. Numeric samples within the OTU tables correspond to the following: 1 Brachythecium sp. 2 Usnea cornuta 3 Dicranum sp. 4 Leucodon julaceus 5 Lobaria quercizans 6 Rhizomnium sp. 7 Dicranum sp. 8 Thuidium delicatulum 9 Myelochroa aurulenta 10 Atrichum angustatum 11 Dicranum sp. 12 Hypnum sp. 13 Atrichum angustatum 14 Hypnum sp. 15 Thuidium delicatulum 16 Leucobryum sp. 17 Polytrichum commune 18 Atrichum angustatum 19 Atrichum angustatum 20 Atrichum crispulum 21 Bryaceae 22 Leucobryum sp. 23 Conocephalum conicum 24 Climacium americanum 25 Atrichum angustatum 26 Huperzia serrata 27 Polytrichum commune 28 Diphasiastrum sp. 29 Anomodon attenuatus 30 Bryoandersonia sp. 31 Polytrichum commune 32 Thuidium delicatulum 33 Brachythecium sp. 34 Leucobryum glaucum 35 Bryoandersonia sp. 36 Anomodon attenuatus 37 Pohlia sp. 38 Cinclidium sp. 39 Hylocomium splendens 40 Polytrichum commune 41 negative control 42 Soil 43 Soil 44 Soil 45 Soil 46 Soil 47 Soil If a sample number is not present within the OTU table; either no sequences were obtained or no sequences passed the quality filtering step in QIIME. Supplemental 8 contains the Summary of unique species per location.
published: 2019-06-03
 
This dataset contains raw data associated with the red fox Y-chromosome assembly (see https://doi.org/10.3390/genes10060409). It includes a fasta file of the 171 scaffolds from the red fox reference genome assembly identified as likely to contain Y-chromosome sequence, the raw BLAST results, and the ABySS assemblies described in the manuscript.
keywords: Y-chromosome; carnivore; Vulpes vulpes; sex chromosomes; MSY; Y-chromosome genes; copy-number variation; BCORY2; UBE1Y; next-generation sequencing
published: 2019-05-31
 
This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"
keywords: denitrification; depressions; microtopography; nitrous oxide; soil oxygen; soil temperature
published: 2019-05-07
 
Data set of trophic cascade in mesocosms experiments for zooplankton (biomass and body size) and phytoplankton (chlorophyll a concentration) caused by Bluegill as well as zooplankton production in those same treatment groups. Zooplankton were collected by tube sampler and phytoplankton were collected through grab samples.
keywords: Trophic cascades; size-selective predation; compensatory mechanisms; biomanipulation; invasive fish; Daphnia; Moina
published: 2019-05-10
 
Data necessary for production of figures presented in "Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models" by Pradhan et al.
keywords: Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models;
published: 2019-05-16
 
The associated data sets include information on stable isotopes from organic matter sources in high elevation lakes, the percentage of production assimilated from the different sources of organic matter, and the relationship between different metrics for trophic position and environmental variables.
keywords: Stable isotopes; macroinvertebrate production; trophic position
published: 2019-05-16
 
This repository includes scripts and datasets for the paper, "Statistically consistent divide-and-conquer pipelines for phylogeny estimation using NJMerge." All data files in this repository are for analyses using the logdet distance matrix computed on the concatenated alignment. Data files for analyses using the average gene-tree internode distance matrix can be downloaded from the Illinois Data Bank (https://doi.org/10.13012/B2IDB-1424746_V1). The latest version of NJMerge can be downloaded from Github (https://github.com/ekmolloy/njmerge).<br /> <strong>List of Changes:</strong> &bull; Updated timings for NJMerge pipelines to include the time required to estimate distance matrices; this impacted files in the following folder: <strong>data.zip</strong> &bull; Replaced "Robinson-Foulds" distance with "Symmetric Difference"; this impacted files in the following folders: <strong> tools.zip; data.zip; scripts.zip</strong> &bull; Added some additional information about the java command used to run ASTRAL-III; this impacted files in the following folders: <strong>data.zip; astral64-trees.tar.gz (new)</strong>
keywords: divide-and-conquer; statistical consistency; species trees; incomplete lineage sorting; phylogenomics
published: 2018-07-29
 
This repository includes scripts, datasets, and supplementary materials for the study, "NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees", presented at RECOMB-CG 2018. The supplementary figures and tables referenced in the main paper can be found in njmerge-supplementary-materials.pdf. The latest version of NJMerge can be downloaded from Github: https://github.com/ekmolloy/njmerge. ***When downloading datasets, please note that the following errors.*** In README.txt, lines 37 and 38 should read: + fasttree-exon.tre contains lines 1-25, 1-100, or 1-1000 of fasttree-total.tre + fasttree-intron.tre contains lines 26-50, 101-200, or 1001-2000 of fasttree-total.tre Note that the file names (fasttree-exon.tre and fasttree-intron.tre) are swapped. In tools.zip, the compare_trees.py and the compare_tree_lists.py scripts incorrectly refer to the "symmetric difference error rate" as the "Robinson-Foulds error rate". Because the normalized symmetric difference and the normalized Robinson-Foulds distance are equal for binary trees, this does not impact the species tree error rates reported in the study. This could impact the gene tree error rates reported in the study (see data-gene-trees.csv in data.zip), as FastTree-2 returns trees with polytomies whenever 3 or more sequences in the input alignment are identical. Note that the normalized symmetric difference is always greater than or equal to the normalized Robinson-Foulds distance, so the gene tree error rates reported in the study are more conservative. In njmerge-supplementary-materials.pdf, the alpha parameter shown in Supplementary Table S2 is actually the divisor D, which is used to compute alpha for each gene as follows. 1. For each gene, a random value X between 0 and 1 is drawn from a uniform distribution. 2. Alpha is computed as -log(X) / D, where D is 4.2 for exons, 1.0 for UCEs, and 0.4 for introns (as stated in Table S2). Note that because the mean of the uniform distribution (between 0 and 1) is 0.5, the mean alpha value is -log(0.5) / 4.2 = 0.16 for exons, -log(0.5) / 1.0 = 0.69 for UCEs, and -log(0.5) / 0.4 = 1.73 for introns.
keywords: phylogenomics; species trees; incomplete lineage sorting; divide-and-conquer
published: 2019-03-19
 
This repository includes scripts and datasets for the paper, "TreeMerge: A new method for improving the scalability of species tree estimation methods." The latest version of TreeMerge can be downloaded from Github (https://github.com/ekmolloy/treemerge).
keywords: divide-and-conquer; statistical consistency; species trees; incomplete lineage sorting; phylogenomics
published: 2018-03-01
 
The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID
keywords: Illumina; next-generation sequencing; ITS; fungi
published: 2019-03-25
 
This dataset contains genotypic and phenotypic data, R scripts, and the results of analysis pertaining to a multi-location field trial of Miscanthus sinensis. Genome-wide association and genomic prediction were performed for biomass yield and 14 yield-component traits across six field trial locations in Asia and North America, using 46,177 single-nucleotide polymorphism (SNP) markers mined from restriction site-associated DNA sequencing (RAD-seq) and 568 M. sinensis accessions. Genomic regions and candidate genes were identified that can be used for breeding improved varieties of M. sinensis, which in turn will be used to generate new M. xgiganteus clones for biomass.
keywords: miscanthus; genotyping-by-sequencing (GBS); genome-wide association studies (GWAS); genomic selection
published: 2019-03-22
 
This data publication provides example video clips related to research on association among flight ability of juvenile songbirds at fledging and juvenile morphological traits (wing emergence, wing length, body condition, mass, and tarsus length. File names reflect the species dropped in each video. These videos are supplemental material for scientific publications by the authors and reflect an example subset of all videos collected form 2017-2018 as part of a larger study on the post-fledging ecology of grassland and shrubland birds in east-Central Illinois, USA. No birds were harmed/injured in the production of these videos and procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 18221. Individuals depicted in the videos have given consent for the videos to be shared (talent/model release form; <a href="https://publicaffairs.illinois.edu/resources/release/">https://publicaffairs.illinois.edu/resources/release/</a>)
keywords: songbirds; flight ability; wing development; wing length; wing emergence; nestling development; post-fledging
published: 2019-03-06
 
Chronic contact exposure to realistic soil concentrations (0, 7.5, 15, and 100 ppb) of the neonicotinoid pesticide imidacloprid had species- and sex-specific effects on bee adult longevity, immature development speed, and mass. This dataset contains a life table tracking the development, mass, and deaths of a single cohort of Osmia lignaria and Megachile rotundata over the course of two summers. Other data files include files created for multi-event survival analysis to analyze the effect on development speed. Detected effects included: decreased adult longevity for female O. lignaria at the highest concentration, a trend for a hormetic effect on female M. rotundata development speed and mass (longest development time and greatest mass in the 15 ppb treatment), and decreased adult longevity and increased development speed at high imidacloprid concentrations as well as a hormetic effect on mass (lowest in the 15 ppb treatment treatment) on male M. rotundata.
keywords: neonicotinoid; imidacloprid; bee; habitat restoration;
published: 2019-03-06
 
This dataset is provided to support the statements in Tarokh, A., and R.Y. Makhnenko. 2019. Remarks on the solid and bulk responses of fluid-filled porous rock, Geophysics. The unjacketed bulk modulus is a poroelastic parameter that can be directly measured in a laboratory test under a loading that preserves the difference between the mean stress and pore pressure constant. For a monomineralic rock, the measurement of the unjacketed bulk modulus is ignored because it is assumed to be equal to the bulk modulus of the solid phase. To examine this assumption, we tested porous sandstones (Berea and Dunnville) and limestones (Apulian and Indiana) mainly composed of quartz and calcite, respectively, under the unjacketed condition. The presence of microscale inhomogeneities, in the form of non-connected (occluded) pores, was shown to cause a considerable difference between the unjacketed bulk modulus and the bulk modulus of the solid phase. Furthermore, we found the unjacketed bulk modulus to be independent of the unjacketed pressure and Terzaghi effective pressure and therefore a constant.
keywords: Poroelasticity; anisotropic solid skeleton; unjacketed bulk modulus; non-connected porosity