Dataset Search

Results generated using SharpTNI on data collected from the 2014 Ebola outbreak in Sierra Leone.

These are the alignments of transcriptome data used for the analysis of members of Heteroptera. This dataset is analyzed in "Deep instability in the phylogenetic backbone of Heteroptera is only partly overcome by transcriptome-based phylogenomics" published in Insect Systematics and Diversity.

This dataset includes a total of 501 images of 42 fossil specimens of Striatopollis and 459 specimens of 45 extant species of the tribe Amherstieae-Fabaceae. These images were taken using Airyscan confocal superresolution microscopy at 630X magnification (63x/NA 1.4 oil DIC). The images are in the CZI file format. They can be opened using Zeiss propriety software (Zen, Zen lite) or in ImageJ. More information on how to open CZI files can be found here: [https://www.zeiss.com/microscopy/us/products/microscope-software/zen/czi.html#microscope---image-data].

Supporting secondary data used in a manuscript currently in submission regarding the invasion dynamics of the asian tiger mosquito, Aedes albopictus, in the state of Illinois

Data was generated from acoustic transmitters implanted in tournament caught and non-angled control largemouth bass across multiple seasons. This data was used to quantify post-release movement, behavior, and mortality in response to angling tournaments at different times of year and varying water temperatures.

These files contain the data presented in the manuscript entitles "Iron redox reactions can drive microtopographic variation in upland soil carbon dioxide and nitrous oxide emissions".

This dataset consists of various input data that are used in the GAMS model. All the data are in the format of .inc which can be read within GAMS or Notepad. Main data sources include: acreage data (acre), crop budget data ($/acre), crop yield data (e.g. bushel/acre), Soil carbon sequestration data (KgCO2/ha/yr). Model details can be found in the "Assessing the Additional Carbon Savings with Biofuel" and GAMS model package. ## File Description (1) GAMS Model.zip: This includes all the input files and scripts for running the model (2) Table*.csv: These files include the data from the tables in the manuscript (3) Figure2_3_4.csv: This contains the data used to create the figures in the manuscript (4) BaselineResults.csv: This includes a summary of the model results. (5) SensitivityResults_*.csv: Model results from the various sensitivity analyses performed (6) LUC_emission.csv: land use change emissions by crop reporting district for changes of pasturelands to annual crops.

This accompanying study is published under the title "Estimating soil N2O emissions induced by organic and inorganic fertilizer inputs using a Tier-2, regression-based meta-analytic approach for U.S. agricultural lands" at Science of the Total Environment. The study is authored by Dr. Yushu Xia, Dr. Hoyoung Kwon, and Dr. Michelle Wander. The DOI for this study is <a href="https://doi.org/10.1016/j.scitotenv.2024.171930">https://doi.org/10.1016/j.scitotenv.2024.171930</a>.

This dataset includes three data files for linking species' climate sensitivity, trait combinations, and listing status. It contains species occurrence data within Hydrologic Unit Code 12 (HUC12) watersheds, along with trait information and Rarity and Climate Sensitivity (RCS) index scores for lotic caddisflies, stoneflies, mussels, dragonflies, and crayfish across all Midwest Climate Adaptation Science Center states: Minnesota, Iowa, Missouri, Wisconsin, Illinois, Indiana, Michigan, and Ohio. For mussels, the geographic scope is expanded to include all Midwest Regional Species of Greatest Conservation Need (RSGCN) states—North Dakota, South Dakota, Nebraska, Kansas, and Kentucky. However, occurrence data for mussels is not included due to data-sharing agreements. Metadata are included with each data file. Please refer to the associated manuscript for original data sources, trait references, and details on the RCS index calculation.

The data in this directory corresponds to: Skinner, R.K., Dietrich, C.H., Walden, K.K.O., Gordon, E., Sweet, A.D., Podsiadlowski, L., Petersen, M., Simon, C., Takiya, D.M., and Johnson, K.P. Phylogenomics of Auchenorrhyncha (Insecta: Hemiptera) using Transcriptomes: Examining Controversial Relationships via Degeneracy Coding and Interrogation of Gene Conflict. Systematic Entomology. Correspondance should be directed to: Rachel K. Skinner, rskinn2@illinois.edu If you use these data, please cite our paper in Systematic Entomology. The following files can be found in this dataset: Amino_acid_concatenated_alignment.phy: the amino acid alignment used in this analysis in phylip format. Amino_acid_raxml_partitions.txt (for reference only): the partitions for the amino acid alignment, but a partitioned amino acid analysis was not performed in this study. Amino_acid_concatenated_tree.newick: the best maximum likelihood tree with bootstrap values in newick format. ASTRAL_input_gene_trees.tre: the concatenated gene tree input file for ASTRAL README_pie_charts.md: explains the the scripts and data needed to recreate the pie charts figure from our paper. There is also another Corresponds to the following files: ASTRAL_species_tree_EN_only.newick: the species tree with only effective number (EN) annotation ASTRAL_species_tree_pp1_only.newick: the species tree with only the posterior probability 1 (main topology) annotation ASTRAL_species_tree_q1_only.newick: the species tree with only the quartet scores for the main topology (q1) ASTRAL_species_tree_q2_only.newick: the species tree with only the quartet scores for the first alternative topology (q2) ASTRAL_species_tree_q3_only.newick: the species tree with only the quartet scores for the second alternative topology (q3) print_node_key_files.py: script needed to create the following files: node_keys.key: text file with node IDs and topologies complete_q_scores.key: text file with node IDs multiplied q scores EN_node_vals.key: text file with node IDs and EN values create_pie_charts_tree.py: script needed to visualize the tree with pie charts, pp1, and EN values plotted at nodes ASTRAL_species_tree_full_annotation.newick: the species tree with full annotation from the ASTRAL analysis. NOTE: It may be more useful to examine individual value files if you want to visualize the tree, e.g., in figtree, since the full annotations are extensive and can make viewing difficult. Complete_NT_concatenated_alignment.phy: the nucleotide alignment that includes unmodified third codon positions. The alignment is in phylip format. Complete_NT_raxml_partitions.txt: the raxml-style partition file of the nucleotide partitions Complete_NT_concatenated_tree.newick: the best maximum likelihood tree from the concatenated complete analysis NT with bootstrap values in newick format Complete_NT_partitioned_tree.newick: the best maximum likelihood tree from the partitioned complete NT analysis with bootstrap values in newick format Degeneracy_coded_nt_concatenated_alignment.phy: the degeneracy coded nucleotide alignment in phylip format Degeneracy_coded_nt_raxml_partitions.txt: the raxml-style partition file for the degeneracy coded nucleotide alignment Degeneracy_coded_nt_concatenated_tree.newick: the best maximum likelihood tree from the degeneracy-coded concatenated analysis with bootstrap values in newick format Degeneracy_coded_nt_partitioned_tree.newick: the best maximum likelihood tree from the degeneracy-coded partitioned analysis with bootstrap values in newick format count_ingroup_taxa.py: script that counts the number of ingroup and/or outgroup taxa present in an alignment

Mitochondrion is generally considered as the most promising subcellular organelle for compartmentalization engineering. Much progress has been made in reconstituting whole metabolic pathways in the mitochondria of yeast to harness the precursor pools (i.e., pyruvate and acetyl-CoA), bypass competing pathways, and minimize transportation limitations. However, only a few mitochondrial targeting sequences (MTSs) have been characterized (i.e., MTS of COX4), limiting the application of compartmentalization engineering for multigene biosynthetic pathways in the mitochondria of yeast. In the present study, based on the mitochondrial proteome, a total of 20 MTSs were cloned and the efficiency of these MTSs in targeting heterologous proteins, including the Escherichia coli FabI and enhanced green fluorescence protein (EGFP) into the mitochondria was evaluated by growth complementation and confocal microscopy. After systematic characterization, six of the well-performed MTSs were chosen for the colocalization of complete biosynthetic pathways into the mitochondria. As proof of concept, the full α-santalene biosynthetic pathway consisting of 10 expression cassettes capable of converting acetyl-coA to α-santalene was compartmentalized into the mitochondria, leading to a 3.7-fold improvement in the production of α-santalene. The newly characterized MTSs should contribute to the expanded metabolic engineering and synthetic biology toolbox for yeast mitochondrial compartmentalization engineering.

This version 2 dataset contains 34 files in total with one (1) additional file, called "Culture-dependent Isolate table with taxonomic determination and sequence data.csv". The remaining files (33) are identical to version 1. The following is the information about the new file and its variables: <b>Culture-dependent Isolate table with taxonomic determination and sequence data.csv</b>: Culture table with assigned taxonomy from NCBI. Single direction sequence for each isolate is include if one could be obtained. Sequence is derived from ITS1F-ITS4 PCR amplicons, with Sanger sequencing in one direction using ITS5. The files contains 20 variables with explanation as below: IsolateNumber : unique number identify each isolate cultured Time: season in which the sample was collected Location: the specific name of the location Habitat: type of habitat : either stream or peatland State: state in the USA in which the specific location is located Incubation_pH ID: pH of the medium during isolation of fungal cultures Genus: phylogenetic genus of the fungal isolates (determined by sequence similarity) Sequence_quality: base call quality of the entire sequence used for blast analysis, if known %_coverage: sequence coverage reported from GenBank %_ID: sequence similarity reported from GenBank Life_style : ecological life style if known Phylum: phylogenetic phylum as indicated by Index Fungorum Subphylum: phylogenetic subphylum as indicated by Index Fungorum Class: phylogenetic class as indicated by Index Fungorum Subclass: phylogenetic subclass as indicated by Index Fungorum Order: phylogenetic order as indicated by Index Fungorum Family: phylogenetic Family as indicated by Index Fungorum ITS5_Sequence: single direction sequence used for sequence similarity match using blastn. Primer ITS5 Fasta: sequence with nomenclature in a fasta format for easy cut and paste into phylogenetic software Note: blank cells mean no data is available or unknown.

Data set of trophic cascade in mesocosms experiments for zooplankton (biomass and body size) and phytoplankton (chlorophyll a concentration) caused by Bluegill as well as zooplankton production in those same treatment groups. Zooplankton were collected by tube sampler and phytoplankton were collected through grab samples.

Data necessary for production of figures presented in "Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models" by Pradhan et al.

Software (Matlab .m files) for the article: Lying in Wait: Modeling the Control of Bacterial Infections via Antibiotic-Induced Proviruses. The files can be used to reproduce the analysis and figures in the article.

This is the dataset used in the Landscape Ecology publication of the same name. This dataset consists of the following files: NWCA_Int_Veg.txt NWCA_Reg_Veg.txt NWCA_Site_Attributes.txt NWCA_Int_Veg.txt is a site and plot by species matrix. Column labeled SITES consists of site IDs. Column labeled Plots consist of Plot ID numbers. All other columns represent species abundances (estimates of percent cover, summed across five plots). NWCA_Reg_Veg.txt is a site by species matrix of species abundances. Column labeled SITES consist of site IDs. All other columns represent species abundances (estimates of percent cover within individual plots). NWCA_Site_Attributes.txt is a matrix of site attributes. Column labeled SITES consist of site IDs. Column labeled AA_CENTER_LAT consist of latitudinal coordinates for the Assessment Area center point in decimal degrees. Column labeled AA_CENTER_LONG consist of longitudinal coordinates for the Assessment Area center point in decimal degrees. Column REFPLUS_NWCA represents disturbance gradient classes including MIN (minimally disturbed), L (least disturbed), I (intermediate), M (most disturbed). Column REFPLUS_NWCA2 represents revised disturbance gradient classes based on protocols described in the article. These revised classes were used for analysis. Column labeled STRESS_HEAVYMETAL represents heavy metal stressor classes, used to ascertain which wetlands were missing soil data. Classes in the STRESS_HEAVYMETAL column include Low, Moderate, High, and Missing. Sites with Missing STRESS_HEAVYMETAL classes were removed from analysis. More information about this dataset: All of the data used in this analysis was gathered from the National Wetlands Condition Assessment. Wetland surveys were conducted from 4/4/2011 to 11/2/2011. The entire National Wetlands Condition Assessment Dataset, which includes 3640 unique taxonomic identities of plants, can be found at: https://www.epa.gov/national-aquatic-resource-surveys/data-national-aquatic-resource-surveys

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"

Nest survival and Fledgling production data for Bell's Vireo and Willow Flycatcher nests.

The Delt_Comb.NEX text file contains the original data used in the phylogenetic analyses of Zahniser & Dietrich, 2013 (European Journal of Taxonomy, 45: 1-211). The text file is marked up according to the standard NEXUS format commonly used by various phylogenetic analysis software packages. The file will be parsed automatically by a variety of programs that recognize NEXUS as a standard bioinformatics file format. The first nine lines of the file indicate the file type (Nexus), that 152 taxa were analyzed, that a total of 3971 characters were analyzed, the format of the data, and specification for two symbols used in the dataset. There are four datasets separated into blocks, one each for: 28S rDNA gene, Histone H3 gene, morphology, and insertion/deletion characters scored based on the alignment of the 28S rDNA dataset. Descriptions of the morphological characters and more details on the species and specimens included in the dataset are provided in the publication using this dataset. A text file, Delt_morph_char.txt, is available here that states the morphological characters and characters states that were scored in the Delt_Comb.NEX dataset. The original DNA sequence data are available from NCBI GenBank under the accession numbers indicated in publication. Chromatogram files for each sequencing read are available from the first author upon request.

The data set contains Supplemental data sets for the Manuscript entitled "Where are they hiding? Testing the body snatchers hypothesis in pyrophilous fungi." Environmental sampling: Amplification of nuclear DNA regions (ITS1 and ITS2) were completed using the Fluidigm Access Array and the resulting amplicons were sequenced on an Illumina MiSeq v2 platform runs using rapid 2 × 250 nt paired-end reads. Illumina sequencing run amplicons that were size selected into <500nt and >500nt sub-pools, then remixed together <500nt: >500nt by nM concentration in a 1x:3x proportion. All amplification and sequencing steps were performed at the Roy J. Carver Biotechnology Center at the University of Illinois Urbana-Champaign. ITS1 region primers consisted of ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-'3) and ITS2 (5'-GCTGCGTTCTTCATCGATGC-'3). ITS2 region primers consisted of fITS7 (5'-GTGARTCATCGAATCTTTG-'3) and ITS4 (5'-TCCTCCGCTTATTGATATGC-'3). Supplemental files 1 through 5 contain the raw data files. Supplemental 1 is the ITS1 Illumina MiSeq forward reads and Supplemental 2 is the corresponding index files. Supplemental 3 is the ITS2 Illumina MiSeq forward reads and Supplemental 4 is the corresponding index files. Supplemental 5 is the map file needed to process the forward reads and index files in QIIME. Supplemental 6 and 7 contain the resulting QIIME 1.9.1. OTU tables along with UNITE, NCBI, and CONSTAX taxonomic assignments in addition to the representative OTU sequence. Numeric samples within the OTU tables correspond to the following: 1 Brachythecium sp. 2 Usnea cornuta 3 Dicranum sp. 4 Leucodon julaceus 5 Lobaria quercizans 6 Rhizomnium sp. 7 Dicranum sp. 8 Thuidium delicatulum 9 Myelochroa aurulenta 10 Atrichum angustatum 11 Dicranum sp. 12 Hypnum sp. 13 Atrichum angustatum 14 Hypnum sp. 15 Thuidium delicatulum 16 Leucobryum sp. 17 Polytrichum commune 18 Atrichum angustatum 19 Atrichum angustatum 20 Atrichum crispulum 21 Bryaceae 22 Leucobryum sp. 23 Conocephalum conicum 24 Climacium americanum 25 Atrichum angustatum 26 Huperzia serrata 27 Polytrichum commune 28 Diphasiastrum sp. 29 Anomodon attenuatus 30 Bryoandersonia sp. 31 Polytrichum commune 32 Thuidium delicatulum 33 Brachythecium sp. 34 Leucobryum glaucum 35 Bryoandersonia sp. 36 Anomodon attenuatus 37 Pohlia sp. 38 Cinclidium sp. 39 Hylocomium splendens 40 Polytrichum commune 41 negative control 42 Soil 43 Soil 44 Soil 45 Soil 46 Soil 47 Soil If a sample number is not present within the OTU table; either no sequences were obtained or no sequences passed the quality filtering step in QIIME. Supplemental 8 contains the Summary of unique species per location.

Datasets used in the study, "TRACTION: Fast non-parametric improvement of estimated gene trees," accepted at the Workshop on Algorithms in Bioinformatics (WABI) 2019.

This dataset provides files for use in analysis of human land preference across Australasia, and in a localized analysis of land preference in Laos and Vietnam. All files can be imported into ArcGIS for visualization, and re-analyzed using the open source Maxent species distribution modeling program. CSV files contain known human presence sites for model validation. ASC files contain geographically coded environmental data for mean annual temperature and mean annual precipitation during the Last Glacial Maximum, as well as downward slope data. All ASC files are in the WGS 1984 Mercator map projection for visualization in ArcGIS and can be opened as text files in text editors supporting large file sizes.

An online and paper knowledge, attitudes, and practices survey on ticks and tick-borne diseases (TBD) was distributed to farmers in Illinois during summer 2020 to spring 2022 (paper version titled Final Draft Farmer KAP_v.SoftCopy_Revised.docx). These are the raw data associated with that survey and the survey questions used (FarmerTickKAPdata.csv, data dictionary in Data Description.docx). We have added calculated values (columns 286 to end, code for calculation in FarmerKAPvariableCalculation.R), including: the tick knowledge score, TBD knowledge score, and total knowledge score, which are the sum of the total number of correct answers in each category, and score percent, which are the proportion of correct answers in each category.