Displaying Dataset 176 - 200 of 321 in total

Subject Area

Life Sciences (164)
Social Sciences (74)
Physical Sciences (40)
Technology and Engineering (28)
Uncategorized (14)
Arts and Humanities (1)


U.S. National Science Foundation (NSF) (83)
Other (83)
U.S. National Institutes of Health (NIH) (34)
U.S. Department of Energy (DOE) (30)
U.S. Department of Agriculture (USDA) (16)
Illinois Department of Natural Resources (IDNR) (8)
U.S. National Aeronautics and Space Administration (NASA) (3)
U.S. Geological Survey (USGS) (3)
U.S. Army (1)

Publication Year

2020 (103)
2019 (74)
2018 (59)
2017 (35)
2016 (30)
2021 (20)


CC0 (185)
CC BY (133)
custom (3)
published: 2019-06-03
This dataset contains raw data associated with the red fox Y-chromosome assembly (see https://doi.org/10.3390/genes10060409). It includes a fasta file of the 171 scaffolds from the red fox reference genome assembly identified as likely to contain Y-chromosome sequence, the raw BLAST results, and the ABySS assemblies described in the manuscript.
keywords: Y-chromosome; carnivore; Vulpes vulpes; sex chromosomes; MSY; Y-chromosome genes; copy-number variation; BCORY2; UBE1Y; next-generation sequencing
published: 2019-05-31
The data are provided to illustrate methods in evaluating systematic transactional data reuse in machine learning. A library account-based recommender system was developed using machine learning processing over transactional data of 383,828 transactions (or check-outs) sourced from a large multi-unit research library. The machine learning process utilized the FP-growth algorithm over the subject metadata associated with physical items that were checked-out together in the library. The purpose of this research is to evaluate the results of systematic transactional data reuse in machine learning. The analysis herein contains a large-scale network visualization of 180,441 subject association rules and corresponding node metrics.
keywords: evaluating machine learning; network science; FP-growth; WEKA; Gephi; personalization; recommender systems
published: 2019-05-31
This dataset includes all data presented in the manuscript entitled: "Dynamic controls on field-scale soil nitrous oxide hot spots and hot moments across a microtopographic gradient"
keywords: denitrification; depressions; microtopography; nitrous oxide; soil oxygen; soil temperature
published: 2019-05-07
Data set of trophic cascade in mesocosms experiments for zooplankton (biomass and body size) and phytoplankton (chlorophyll a concentration) caused by Bluegill as well as zooplankton production in those same treatment groups. Zooplankton were collected by tube sampler and phytoplankton were collected through grab samples.
keywords: Trophic cascades; size-selective predation; compensatory mechanisms; biomanipulation; invasive fish; Daphnia; Moina
published: 2019-05-10
Data necessary for production of figures presented in "Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models" by Pradhan et al.
keywords: Efficient enzyme coupling algorithms identify functional pathways in genome-scale metabolic models;
published: 2019-05-16
The associated data sets include information on stable isotopes from organic matter sources in high elevation lakes, the percentage of production assimilated from the different sources of organic matter, and the relationship between different metrics for trophic position and environmental variables.
keywords: Stable isotopes; macroinvertebrate production; trophic position
published: 2018-11-20
A dataset of acoustic impulse responses for microphones worn on the body. Microphones were placed at 80 positions on the body of a human subject and a plastic mannequin. The impulse responses can be used to study the acoustic effects of the body and can be convolved with sound sources to simulate wearable audio devices and microphone arrays. The dataset also includes measurements with different articles of clothing covering some of the microphones and with microphones placed on different hats and accessories. The measurements were performed from 24 angles of arrival in an acoustically treated laboratory. Related Paper: Ryan M. Corey, Naoki Tsuda, and Andrew C. Singer. "Acoustic Impulse Responses for Wearable Audio Devices," IEEE International Conference on Acoustics, Speech, and Signal Processing (ICASSP), Brighton, UK, May 2019. All impulse responses are sampled at 48 kHz and truncated to 500 ms. The impulse response data is provided in WAVE audio and MATLAB data file formats. The microphone locations are provided in tab-separated-value files for each experiment and are also depicted graphically in the documentation. The file wearable_mic_dataset_full.zip contains both WAVE- and MATLAB-format impulse responses. The file wearable_mic_dataset_matlab.zip contains only MATLAB-format impulse responses. The file wearable_mic_dataset_wave.zip contains only WAVE-format impulse responses.
keywords: Acoustic impulse responses; microphone arrays; wearables; hearing aids; audio source separation
published: 2019-05-22
This is the experimental data of isolated nanomagnet islands with or without the presence of large nanomagnet islands. The small islands are made of Permalloy materials with size of 170 nm by 470 nm by 2.5 nm. The systems are measured at a temperature where the small islands are fluctuating around room temperature. The data is recorded as photoemission electron microscopy intensity. More details about the data can be found in the note.txt and Spe_2016.xlsx file. Note: The raw data folders are stored in five volumes during the compression. All five volumes are needed in order to recover the original folder.
keywords: artificial spin ice; magnetism
published: 2019-05-20
This is the experimental data of tetris artificial spin ice. The islands are made of Permalloy materials with size of 170 nm by 470 nm by 2.5 nm. The systems are measured at a temperature where the islands are fluctuating around room temperature. The data is recorded as photoemission electron microscopy intensity. More details about the dataset can be found in the file Note.txt and Tetris_data_list.xlsx Note: 2 files name bl11_teris600_033 and bl11_tetris600_2_135 are not recorded in the excel sheet because they are corrupted during the measurement. Any data that is not recorded in the excel sheet is either corrupted or of low quality. From files *_028 to *_049, tetris is spelled with “t” while in the raw data folder without “t”. This is a typo. Throughout the dataset, tetris and teris are supposed to have the same meaning.
keywords: artificial spin ice
published: 2019-05-16
This repository includes scripts and datasets for the paper, "Statistically consistent divide-and-conquer pipelines for phylogeny estimation using NJMerge." All data files in this repository are for analyses using the logdet distance matrix computed on the concatenated alignment. Data files for analyses using the average gene-tree internode distance matrix can be downloaded from the Illinois Data Bank (https://doi.org/10.13012/B2IDB-1424746_V1). The latest version of NJMerge can be downloaded from Github (https://github.com/ekmolloy/njmerge).<br /> <strong>List of Changes:</strong> &bull; Updated timings for NJMerge pipelines to include the time required to estimate distance matrices; this impacted files in the following folder: <strong>data.zip</strong> &bull; Replaced "Robinson-Foulds" distance with "Symmetric Difference"; this impacted files in the following folders: <strong> tools.zip; data.zip; scripts.zip</strong> &bull; Added some additional information about the java command used to run ASTRAL-III; this impacted files in the following folders: <strong>data.zip; astral64-trees.tar.gz (new)</strong>
keywords: divide-and-conquer; statistical consistency; species trees; incomplete lineage sorting; phylogenomics
published: 2019-05-01
This dataset contains scripts and data developed as a part of the research manuscript titled “Spatial and Temporal Allocation of Ammonia Emissions from Fertilizer Application Important for Air Quality Predictions in U.S. Corn Belt”. This includes (1) Spatial and temporal factors for ammonia emissions from agricultural fertilizer usage developed using the hybrid ISS-DNDC method for the Midwest U.S., (2) CAMx job scripts and outputs of predictions of ambient ammonia and total and speciated PM2.5, (3) Observation data used to statistically evaluate CAMx predictions, and (4) MATLAB programs developed to pair CAMx predictions with ground-based observation data in space and time.
keywords: Air quality; Ammonia; Emissions; PM2.5; CAMx; DNDC; spatial resolution; Midwest U.S.
published: 2019-04-05
File Name: Inclusion_Criteria_Annotation.csv Data Preparation: Xiaoru Dong Date of Preparation: 2019-04-04 Data Contributions: Jingyi Xie, Xiaoru Dong, Linh Hoang Data Source: Cochrane systematic reviews published up to January 3, 2018 by 52 different Cochrane groups in 8 Cochrane group networks. Associated Manuscript authors: Xiaoru Dong, Jingyi Xie, Linh Hoang, and Jodi Schneider. Associated Manuscript, Working title: Machine classification of inclusion criteria from Cochrane systematic reviews. Description: The file contains lists of inclusion criteria of Cochrane Systematic Reviews and the manual annotation results. 5420 inclusion criteria were annotated, out of 7158 inclusion criteria available. Annotations are either "Only RCTs" or "Others". There are 2 columns in the file: - "Inclusion Criteria": Content of inclusion criteria of Cochrane Systematic Reviews. - "Only RCTs": Manual Annotation results. In which, "x" means the inclusion criteria is classified as "Only RCTs". Blank means that the inclusion criteria is classified as "Others". Notes: 1. "RCT" stands for Randomized Controlled Trial, which, in definition, is "a work that reports on a clinical trial that involves at least one test treatment and one control treatment, concurrent enrollment and follow-up of the test- and control-treated groups, and in which the treatments to be administered are selected by a random process, such as the use of a random-numbers table." [Randomized Controlled Trial publication type definition from https://www.nlm.nih.gov/mesh/pubtypes.html]. 2. In order to reproduce the relevant data to this, please get the code of the project published on GitHub at: https://github.com/XiaoruDong/InclusionCriteria and run the code following the instruction provided. 3. This datafile (V2) is a updated version of the datafile published at https://doi.org/10.13012/B2IDB-5958960_V1 with some minor spelling mistakes in the data fixed.
keywords: Inclusion criteri; Randomized controlled trials; Machine learning; Systematic reviews
published: 2018-07-29
This repository includes scripts, datasets, and supplementary materials for the study, "NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees", presented at RECOMB-CG 2018. The supplementary figures and tables referenced in the main paper can be found in njmerge-supplementary-materials.pdf. The latest version of NJMerge can be downloaded from Github: https://github.com/ekmolloy/njmerge. ***When downloading datasets, please note that the following errors.*** In README.txt, lines 37 and 38 should read: + fasttree-exon.tre contains lines 1-25, 1-100, or 1-1000 of fasttree-total.tre + fasttree-intron.tre contains lines 26-50, 101-200, or 1001-2000 of fasttree-total.tre Note that the file names (fasttree-exon.tre and fasttree-intron.tre) are swapped. In tools.zip, the compare_trees.py and the compare_tree_lists.py scripts incorrectly refer to the "symmetric difference error rate" as the "Robinson-Foulds error rate". Because the normalized symmetric difference and the normalized Robinson-Foulds distance are equal for binary trees, this does not impact the species tree error rates reported in the study. This could impact the gene tree error rates reported in the study (see data-gene-trees.csv in data.zip), as FastTree-2 returns trees with polytomies whenever 3 or more sequences in the input alignment are identical. Note that the normalized symmetric difference is always greater than or equal to the normalized Robinson-Foulds distance, so the gene tree error rates reported in the study are more conservative. In njmerge-supplementary-materials.pdf, the alpha parameter shown in Supplementary Table S2 is actually the divisor D, which is used to compute alpha for each gene as follows. 1. For each gene, a random value X between 0 and 1 is drawn from a uniform distribution. 2. Alpha is computed as -log(X) / D, where D is 4.2 for exons, 1.0 for UCEs, and 0.4 for introns (as stated in Table S2). Note that because the mean of the uniform distribution (between 0 and 1) is 0.5, the mean alpha value is -log(0.5) / 4.2 = 0.16 for exons, -log(0.5) / 1.0 = 0.69 for UCEs, and -log(0.5) / 0.4 = 1.73 for introns.
keywords: phylogenomics; species trees; incomplete lineage sorting; divide-and-conquer
published: 2018-09-06
The XSEDE program manages the database of allocation awards for the portfolio of advanced research computing resources funded by the National Science Foundation (NSF). The database holds data for allocation awards dating to the start of the TeraGrid program in 2004 to present, with awards continuing through the end of the second XSEDE award in 2021. The project data include lead researcher and affiliation, title and abstract, field of science, and the start and end dates. Along with the project information, the data set includes resource allocation and usage data for each award associated with the project. The data show the transition of resources over a fifteen year span along with the evolution of researchers, fields of science, and institutional representation.
keywords: allocations; cyberinfrastructure; XSEDE
published: 2019-03-19
This repository includes scripts and datasets for the paper, "TreeMerge: A new method for improving the scalability of species tree estimation methods." The latest version of TreeMerge can be downloaded from Github (https://github.com/ekmolloy/treemerge).
keywords: divide-and-conquer; statistical consistency; species trees; incomplete lineage sorting; phylogenomics
published: 2018-03-01
The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID
keywords: Illumina; next-generation sequencing; ITS; fungi
published: 2019-03-05
This dataset contains the raw nuclear background radiation data collected in the engineering campus of University of Illinois at Urbana-Champaign. It contains three columns, x, y, and counts, which corresponds to longitude, latitude, and radiation count rate (counts per second). In addition to the original background radiation data, there are several separate files that contain the simulated radioactive sources. For more detailed README file, please refer to this documentation: <a href= "https://www.dropbox.com/s/xjhmeog7fvijml7/README.pdf?dl=0">https://www.dropbox.com/s/xjhmeog7fvijml7/README.pdf?dl=0</a>
keywords: Nuclear Radiation
published: 2019-03-19
This dataset includes images and extracted centerlines from experiments looking at the formation and evolution of meltwater meandering channels on ice. The laboratory data includes centimeter- and millimeter-scale rivulets. Dataset also includes an image and corresponding centerlines from the Peterman Ice Island. All centerlines were manually digitized in Matlab but no distributable code was developed for the process. Once digitized, centerlines were smoothed and standardized following methods and routines developed by other authors (Zolezzi and Guneralp, 2016; Guneralp and Rhoads, 2008). Details about the preparation of the centerlines and processing with these methods is included in the dissertation by Fernández (2018) linked to this dataset. "Millimeter scale and Peterman Ice Island centerlines.pdf": This file includes the images of two mm-scale experimetns and the Peterman Ice Island image. Seventeen centerlines were digitized from the former and seven were digitized from the latter. Those centerlines are shown above the images themselves. "Centimeter scale rivulet images.pdf": This file includes images corresponding to all cm-scale centerlines used for the analysis presented in the dissertation by Fernandez (2018). Each image has a short caption indicating the run ID and the time at which it was captured. The images were used to extract centerlines to look at the planform evolution of cm-scale meltwater meandering rivulets on ice. Images include 26 centerlines from four different runs. "Meltwater meandering channel centerlines.xlsx": This spreadsheet contains the centerline data for all fifty centerlines. The workbook includes 51 sheets. The first 50 are related to each one of the channels. The mm scale and Peterman Ice Island ones are identified using the same IDs shown in "Millimeter scale and Peterman Ice Island centerlines.pdf". The cm-scale centerlines are identified by run ID and a number indicating the time in minutes (with t = 0 min being the time at which water started flowing over the ice block). The naming convention is also associated to the images in "Centimeter scale rivulet images.pdf". The last sheet in the workbook includes a summary of the channel widths measured from every image for each centerline. The 50 sheets with the centerline information have four columns each. The titles of the columns are X, Y, S, and C. X,Y are dimensionless coordinates of the centerline. S is dimensionless streamwise coordinate (location along the centerline). C is dimensionless curvature value. All these values were non-dimensionalized with the channel width. See Fernandez (2018), Zolezzi and Guneralp (2016), and Guneralp and Rhoads (2008) for more details regarding the process of smoothing, standardizing and non-dimensionalization of the centerline coordinates.
keywords: Meltwater, Meandering, Ice, Supraglacial, Experiments
published: 2019-03-25
This dataset contains genotypic and phenotypic data, R scripts, and the results of analysis pertaining to a multi-location field trial of Miscanthus sinensis. Genome-wide association and genomic prediction were performed for biomass yield and 14 yield-component traits across six field trial locations in Asia and North America, using 46,177 single-nucleotide polymorphism (SNP) markers mined from restriction site-associated DNA sequencing (RAD-seq) and 568 M. sinensis accessions. Genomic regions and candidate genes were identified that can be used for breeding improved varieties of M. sinensis, which in turn will be used to generate new M. xgiganteus clones for biomass.
keywords: miscanthus; genotyping-by-sequencing (GBS); genome-wide association studies (GWAS); genomic selection
published: 2019-03-22
This data publication provides example video clips related to research on association among flight ability of juvenile songbirds at fledging and juvenile morphological traits (wing emergence, wing length, body condition, mass, and tarsus length. File names reflect the species dropped in each video. These videos are supplemental material for scientific publications by the authors and reflect an example subset of all videos collected form 2017-2018 as part of a larger study on the post-fledging ecology of grassland and shrubland birds in east-Central Illinois, USA. No birds were harmed/injured in the production of these videos and procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 18221. Individuals depicted in the videos have given consent for the videos to be shared (talent/model release form; <a href="https://publicaffairs.illinois.edu/resources/release/">https://publicaffairs.illinois.edu/resources/release/</a>)
keywords: songbirds; flight ability; wing development; wing length; wing emergence; nestling development; post-fledging
published: 2019-03-06
Chronic contact exposure to realistic soil concentrations (0, 7.5, 15, and 100 ppb) of the neonicotinoid pesticide imidacloprid had species- and sex-specific effects on bee adult longevity, immature development speed, and mass. This dataset contains a life table tracking the development, mass, and deaths of a single cohort of Osmia lignaria and Megachile rotundata over the course of two summers. Other data files include files created for multi-event survival analysis to analyze the effect on development speed. Detected effects included: decreased adult longevity for female O. lignaria at the highest concentration, a trend for a hormetic effect on female M. rotundata development speed and mass (longest development time and greatest mass in the 15 ppb treatment), and decreased adult longevity and increased development speed at high imidacloprid concentrations as well as a hormetic effect on mass (lowest in the 15 ppb treatment treatment) on male M. rotundata.
keywords: neonicotinoid; imidacloprid; bee; habitat restoration;
published: 2019-03-06
This dataset is provided to support the statements in Tarokh, A., and R.Y. Makhnenko. 2019. Remarks on the solid and bulk responses of fluid-filled porous rock, Geophysics. The unjacketed bulk modulus is a poroelastic parameter that can be directly measured in a laboratory test under a loading that preserves the difference between the mean stress and pore pressure constant. For a monomineralic rock, the measurement of the unjacketed bulk modulus is ignored because it is assumed to be equal to the bulk modulus of the solid phase. To examine this assumption, we tested porous sandstones (Berea and Dunnville) and limestones (Apulian and Indiana) mainly composed of quartz and calcite, respectively, under the unjacketed condition. The presence of microscale inhomogeneities, in the form of non-connected (occluded) pores, was shown to cause a considerable difference between the unjacketed bulk modulus and the bulk modulus of the solid phase. Furthermore, we found the unjacketed bulk modulus to be independent of the unjacketed pressure and Terzaghi effective pressure and therefore a constant.
keywords: Poroelasticity; anisotropic solid skeleton; unjacketed bulk modulus; non-connected porosity
published: 2019-02-26
We have recently created an approach for high throughput single cell measurements using matrix assisted laser desorption / ionization mass spectrometry (MALDI MS) (J Am Soc Mass Spectrom. 2017, 28, 1919-1928. doi: 10.1007/s13361-017-1704-1. Chemphyschem. 2018, 19, 1180-1191. doi: 10.1002/cphc.201701364). While chemical detail is obtained on individual cells, it has not been possible to correlate the chemical information with canonical cell types. Now we combine high-throughput single cell mass spectrometry with immunocytochemistry to determine lipid profiles of two known cell types, astrocytes and neurons from the rodent brain, with the work appearing as “Lipid heterogeneity between astrocytes and neurons revealed with single cell MALDI MS supervised by immunocytochemical classification” (DOI: 10.1002/anie.201812892). Here we provide the data collected for this study. The dataset provides the raw data and script files for the rodent cerebral cells described in the manuscript.
keywords: Single cell analysis; mass spectrometry; astrocyte; neuron; lipid analysis