Dataset Search Results

¹²CO and ¹³CO maps for six molecular clouds in the Large Magellanic Cloud, obtained with the Atacama Large Millimeter/submillimeter Array (ALMA). See the associated article in the Astrophysical Journal, and README files within each ZIP archive. Please cite the article if you use these data.

Citation context annotation for papers citing retracted paper Matsuyama 2005 (RETRACTED: Matsuyama W, Mitsuyama H, Watanabe M, Oonakahara KI, Higashimoto I, Osame M, Arimura K. Effects of omega-3 polyunsaturated fatty acids on inflammatory markers in COPD. Chest. 2005 Dec 1;128(6):3817-27.), retracted in 2008 (Retraction in: Chest (2008) 134:4 (893) <a href="https://doi.org/10.1016/S0012-3692(08)60339-6">https://doi.org/10.1016/S0012-3692(08)60339-6<a/> ). This is part of the supplemental data for Jodi Schneider, Di Ye, Alison Hill, and Ashley Whitehorn. "Continued Citation of a Fraudulent Clinical Trial Report, Eleven Years after it was retracted for Falsifying Data" [R&R under review with Scientometrics]. Overall we found 148 citations to the retracted paper from 2006 to 2019, However, this dataset does not include the annotations described in the 2015. in Ashley Fulton, Alison Coates, Marie Williams, Peter Howe, and Alison Hill. "Persistent citation of the only published randomized controlled trial of omega-3 supplementation in chronic obstructive pulmonary disease six years after its retraction." Publications 3, no. 1 (2015): 17-26. In this dataset 70 new and newly found citations are listed: 66 annotated citations and 4 pending citations (non-annotated since we don't have full-text). "New citations" refer to articles published from March 25, 2014 to 2019, found in Google Scholar and Web of Science. "Newly found citations" refer articles published 2006-2013, found in Google Scholar and Web of Science, but not previously covered in Ashley Fulton, Alison Coates, Marie Williams, Peter Howe, and Alison Hill. "Persistent citation of the only published randomised controlled trial of omega-3 supplementation in chronic obstructive pulmonary disease six years after its retraction." Publications 3, no. 1 (2015): 17-26. NOTES: This is Unicode data. Some publication titles & quotes are in non-Latin characters and they may contain commas, quotation marks, etc. FILES/FILE FORMATS Same data in two formats: 2006-2019-new-citation-contexts-to-Matsuyama.csv - Unicode CSV (preservation format only) 2006-2019-new-citation-contexts-to-Matsuyama.xlsx - Excel workbook (preferred format) ROW EXPLANATIONS 70 rows of data - one citing publication per row COLUMN HEADER EXPLANATIONS Note - processing notes Annotation pending - Y or blank Year Published - publication year ID - ID corresponding to the network analysis. See Ye, Di; Schneider, Jodi (2019): Network of First and Second-generation citations to Matsuyama 2005 from Google Scholar and Web of Science. University of Illinois at Urbana-Champaign. <a href="https://doi.org/10.13012/B2IDB-1403534_V2">https://doi.org/10.13012/B2IDB-1403534_V2</a> Title - item title (some have non-Latin characters, commas, etc.) Official Translated Title - item title in English, as listed in the publication Machine Translated Title - item title in English, translated by Google Scholar Language - publication language Type - publication type (e.g., bachelor's thesis, blog post, book chapter, clinical guidelines, Cochrane Review, consumer-oriented evidence summary, continuing education journal article, journal article, letter to the editor, magazine article, Master's thesis, patent, Ph.D. thesis, textbook chapter, training module) Book title for book chapters - Only for a book chapter - the book title University for theses - for bachelor's thesis, Master's thesis, Ph.D. thesis - the associated university Pre/Post Retraction - "Pre" for 2006-2008 (means published before the October 2008 retraction notice or in the 2 months afterwards); "Post" for 2009-2019 (considered post-retraction for our analysis) Identifier where relevant - ISBN, Patent ID, PMID (only for items we considered hard to find/identify, e.g. those without a DOI-based URL) URL where available - URL, ideally a DOI-based URL Reference number/style - reference Only in bibliography - Y or blank Acknowledged - If annotated, Y, Not relevant as retraction not published yet, or N (blank otherwise) Positive / "Poor Research" (Negative) - P for positive, N for negative if annotated; blank otherwise Human translated quotations - Y or blank; blank means Google scholar was used to translate quotations for Translated Quotation X Specific/in passing (overall) - Specific if any of the 5 quotations are specific [aggregates Specific / In Passing (Quotation X)] Quotation 1 - First quotation (or blank) (includes non-Latin characters in some cases) Translated Quotation 1 - English translation of "Quotation 1" (or blank) Specific / In Passing (Quotation 1) - Specific if "Quotation 1" refers to methods or results of the Matsuyama paper (or blank) What is referenced from Matsuyama (Quotation 1) - Methods; Results; or Methods and Results - blank if "Quotation 1" not specific, no associated quotation, or not yet annotated Quotation 2 - Second quotation (includes non-Latin characters in some cases) Translated Quotation 2 - English translation of "Quotation 2" Specific / In Passing (Quotation 2) - Specific if "Quotation 2" refers to methods or results of the Matsuyama paper (or blank) What is referenced from Matsuyama (Quotation 2) - Methods; Results; or Methods and Results - blank if "Quotation 2" not specific, no associated quotation, or not yet annotated Quotation 3 - Third quotation (includes non-Latin characters in some cases) Translated Quotation 3 - English translation of "Quotation 3" Specific / In Passing (Quotation 3) - Specific if "Quotation 3" refers to methods or results of the Matsuyama paper (or blank) What is referenced from Matsuyama (Quotation 3) - Methods; Results; or Methods and Results - blank if "Quotation 3" not specific, no associated quotation, or not yet annotated Quotation 4 - Fourth quotation (includes non-Latin characters in some cases) Translated Quotation 4 - English translation of "Quotation 4" Specific / In Passing (Quotation 4) - Specific if "Quotation 4" refers to methods or results of the Matsuyama paper (or blank) What is referenced from Matsuyama (Quotation 4) - Methods; Results; or Methods and Results - blank if "Quotation 4" not specific, no associated quotation, or not yet annotated Quotation 5 - Fifth quotation (includes non-Latin characters in some cases) Translated Quotation 5 - English translation of "Quotation 5" Specific / In Passing (Quotation 5) - Specific if "Quotation 5" refers to methods or results of the Matsuyama paper (or blank) What is referenced from Matsuyama (Quotation 5) - Methods; Results; or Methods and Results - blank if "Quotation 5" not specific, no associated quotation, or not yet annotated Further Notes - additional notes

Human annotations of randomly selected judged documents from the AP 88-89, Robust 2004, WT10g, and GOV2 TREC collections. Seven annotators were asked to read documents in their entirety and then select up to ten terms they felt best represented the main topic(s) of the document. Terms were chosen from among a set sampled from the document in question and from related documents.

VCF files used to analyze a novel filtering tool VEF, presented in the article "VEF: a Variant Filtering tool based on Ensemble methods".

This dataset contains gamma-ray spectra templates for a source interdiction and uranium enrichment measurement task. This dataset also contains Keras machine learning models trained using datasets created using these templates.

Data sets relating to the manuscript “Long-term yields in annual and perennial bioenergy crops in the Midwestern USA” published in Global Change Biology Bioenergy. Field data, including annual peak biomass and harvest yields from maize/soy, miscanthus, switchgrass, and prairie field trials from 2008-2018 are included. Peak and harvest biomass for fertilized and unfertilized miscanthus are included from 2014-2018.

Data in this publication were used to examine the effects of environmental and temporal covariates on detection probability, and the effects of habitat and landscape level covariates on occupancy and within season turnover of Black-billed Cuckoos and Yellow-billed Cuckoos. Data were collected between 2019-2020 in northern Illinois, USA. Procedures were approved by the Illinois Institutional Animal Care and Use Committee (IACUC), protocol no. 19086.

This is a set of topographies to study the magnetic field response of RbV3Sb5 (related to Fig.4 of https://www.nature.com/articles/s41586-024-07519-5)

This set of scripts accompanies the manuscript describing the R package polyRAD, which uses DNA sequence read depth to estimate allele dosage in diploids and polyploids. Using several high-confidence SNP datasets from various species, allelic read depth from a typical RAD-seq dataset was simulated, then genotypes were estimated with polyRAD and other software and compared to the true genotypes, yielding error estimates.

This dataset contains records of five years of interlibrary loan (ILL) transactions for the University of Illinois at Urbana-Champaign Library. It is for the materials lent to other institutions during period 2009-2013. It includes 169,890 transactions showing date; borrowing institution’s type, state and country; material format, imprint city, imprint country, imprint region, call number, language, local circulation count, ILL lending count, and OCLC holdings count. The dataset was generated putting together monthly ILL reports. Circulation and ILL lending fields were added from the ILS records. Borrower region and imprint region fields are created based on Title VI Region List. OCLC holdings field has been added from WorldCat records.

This repository include datasets that are studied with INC/INC-ML/INC-NJ in the paper `Using INC within Divide-and-Conquer Phylogeny Estimation' that was submitted to AICoB 2019. Each dataset has its own readme.txt that further describes the creation process and other parameters/softwares used in making these datasets. The latest implementation of INC/INC-ML/INC-NJ can be found on https://github.com/steven-le-thien/constraint_inc. Note: there may be files with DS_STORE as extension in the datasets; please ignore these files.

The Allan Lab has published a Fluidigm pipeline online. This is the url: https://github.com/HPCBio/allan-fluidigm-pipeline. This url includes a tutorial for running the pipeline. However it does not have test datasets yet. This tarball hosted at the Illinois Data Bank is the dataset that completes the github tutorial. It includes inputs (custom database of tick pathogens and fluidigm raw reads) and output files (tables of samples with taxonomic classifications).

Dataset providing calculation of a Competition Index (CI) for Late Pleistocene carnivore guilds in Laos and Vietnam and their relationship to humans. Prey mass spectra, Prey focus masses, and prey class raw data can be used to calculate the CI following Hemmer (2004). Mass estimates were calculated for each species following Van Valkenburgh (1990). Full citations to methodological papers are included as relationships with other resources

Contains scattering data obtained for (TaSe4)2I at the Advanced Photon Source at Argonne National Laboratory. Beamline 6ID-D was used with a beam energy of 64.8 keV in a transmission geometry. Data was obtained at temperatures between 28 and 300 K. See the readme.txt file for more information.

This dataset consists of a citation graph. It was constructed by downloading and parsing the Works section of the Open Alex catalog of the global research system. Open Alex (see citation below) contains detailed information about scholarly research, including articles, authors, journals, institutions, and their relationships. The data were downloaded on 2024-07-15. The dataset comprises two compressed (.xz) files. 1) filename: openalexID_integer_id_hasDOI.parquet.xz. The tabular data within contains three columns: openalex_id, integer_id, and hasDOI. Each row represents a record with the following data types: • openalex_id: A unique identifier from the Open Alex catalog. • integer_id: An integer representing the new identifier (assigned by the authors) • hasDOI: An integer (0 or 1) indicating whether the record has a DOI (0 for no, 1 for yes). 2) filename: citation_table.tsv.xz This edgelist of citations has two columns (no header) of integer values that represent citing and cited integer_id, respectively. Summary Features • Total Nodes (Documents): 256,997,006 • Total Edges (citations): 2,148,871,058 • Documents with DOIs: 163,495,446 • Edges between documents with DOIs: 1,936,722,541 The code used to generate these files can be found here: https://github.com/illinois-or-research-analytics/lorran_openalex/

Enclosed in this dataset are transport data of kagome connected artificial spin ice networks composed of permalloy nanowires. The data herein are reproductions of the data seen in Appendix B of the dissertation titled "Magnetotransport of Connected Artificial Spin Ice". Field sweeps with the magnetic field applied in-plane were performed in 5 degree increments for armchair orientation kagome artificial spin ice and zigzag orientation kagome artificial spin ice.

If you use this dataset, please cite the IJRR data paper (bibtex is below). We present a dataset collected from a canoe along the Sangamon River in Illinois. The canoe was equipped with a stereo camera, an IMU, and a GPS device, which provide visual data suitable for stereo or monocular applications, inertial measurements, and position data for ground truth. We recorded a canoe trip up and down the river for 44 minutes covering 2.7 km round trip. The dataset adds to those previously recorded in unstructured environments and is unique in that it is recorded on a river, which provides its own set of challenges and constraints that are described in this paper. The data is divided into subsets, which can be downloaded individually. Video previews are available on Youtube: https://www.youtube.com/channel/UCOU9e7xxqmL_s4QX6jsGZSw The information below can also be found in the README files provided in the 527 dataset and each of its subsets. The purpose of this document is to assist researchers in using this dataset. Images ====== Raw --- The raw images are stored in the cam0 and cam1 directories in bmp format. They are bayered images that need to be debayered and undistorted before they are used. The camera parameters for these images can be found in camchain-imucam.yaml. Note that the camera intrinsics describe a 1600x1200 resolution image, so the focal length and center pixel coordinates must be scaled by 0.5 before they are used. The distortion coefficients remain the same even for the scaled images. The camera to imu tranformation matrix is also in this file. cam0/ refers to the left camera, and cam1/ refers to the right camera. Rectified --------- Stereo rectified, undistorted, row-aligned, debayered images are stored in the rectified/ directory in the same way as the raw images except that they are in png format. The params.yaml file contains the projection and rotation matrices necessary to use these images. The resolution of these parameters do not need to be scaled as is necessary for the raw images. params.yml ---------- The stereo rectification parameters. R0,R1,P0,P1, and Q correspond to the outputs of the OpenCV stereoRectify function except that 1s and 2s are replaced by 0s and 1s, respectively. R0: The rectifying rotation matrix of the left camera. R1: The rectifying rotation matrix of the right camera. P0: The projection matrix of the left camera. P1: The projection matrix of the right camera. Q: Disparity to depth mapping matrix T_cam_imu: Transformation matrix for a point in the IMU frame to the left camera frame. camchain-imucam.yaml -------------------- The camera intrinsic and extrinsic parameters and the camera to IMU transformation usable with the raw images. T_cam_imu: Transformation matrix for a point in the IMU frame to the camera frame. distortion_coeffs: lens distortion coefficients using the radial tangential model. intrinsics: focal length x, focal length y, principal point x, principal point y resolution: resolution of calibration. Scale the intrinsics for use with the raw 800x600 images. The distortion coefficients do not change when the image is scaled. T_cn_cnm1: Transformation matrix from the right camera to the left camera. Sensors ------- Here, each message in name.csv is described ###rawimus### time # GPS time in seconds message name # rawimus acceleration_z # m/s^2 IMU uses right-forward-up coordinates -acceleration_y # m/s^2 acceleration_x # m/s^2 angular_rate_z # rad/s IMU uses right-forward-up coordinates -angular_rate_y # rad/s angular_rate_x # rad/s ###IMG### time # GPS time in seconds message name # IMG left image filename right image filename ###inspvas### time # GPS time in seconds message name # inspvas latitude longitude altitude # ellipsoidal height WGS84 in meters north velocity # m/s east velocity # m/s up velocity # m/s roll # right hand rotation about y axis in degrees pitch # right hand rotation about x axis in degrees azimuth # left hand rotation about z axis in degrees clockwise from north ###inscovs### time # GPS time in seconds message name # inscovs position covariance # 9 values xx,xy,xz,yx,yy,yz,zx,zy,zz m^2 attitude covariance # 9 values xx,xy,xz,yx,yy,yz,zx,zy,zz deg^2 velocity covariance # 9 values xx,xy,xz,yx,yy,yz,zx,zy,zz (m/s)^2 ###bestutm### time # GPS time in seconds message name # bestutm utm zone # numerical zone utm character # alphabetical zone northing # m easting # m height # m above mean sea level Camera logs ----------- The files name.cam0 and name.cam1 are text files that correspond to cameras 0 and 1, respectively. The columns are defined by: unused: The first column is all 1s and can be ignored. software frame number: This number increments at the end of every iteration of the software loop. camera frame number: This number is generated by the camera and increments each time the shutter is triggered. The software and camera frame numbers do not have to start at the same value, but if the difference between the initial and final values is not the same, it suggests that frames may have been dropped. camera timestamp: This is the cameras internal timestamp of the frame capture in units of 100 milliseconds. PC timestamp: This is the PC time of arrival of the image. name.kml -------- The kml file is a mapping file that can be read by software such as Google Earth. It contains the recorded GPS trajectory. name.unicsv ----------- This is a csv file of the GPS trajectory in UTM coordinates that can be read by gpsbabel, software for manipulating GPS paths. @article{doi:10.1177/0278364917751842, author = {Martin Miller and Soon-Jo Chung and Seth Hutchinson}, title ={The Visual–Inertial Canoe Dataset}, journal = {The International Journal of Robotics Research}, volume = {37}, number = {1}, pages = {13-20}, year = {2018}, doi = {10.1177/0278364917751842}, URL = {https://doi.org/10.1177/0278364917751842}, eprint = {https://doi.org/10.1177/0278364917751842} }

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included. File descriptions: Great_lakes_Map_coordinates.xlsx = coordinates of sample sites QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region. QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME. ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region. Resulting OTU Table and OTU table with taxonomy ITS1 Region wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev ITS2 Region wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample. wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev Rarified illumina dataset for each ITS Region ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region. ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region. Column headings: #SampleID = code including researcher initials and sequential run number BarcodeSequence = LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC run_prefix = initials of run operator Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates. DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)" Depth_Meters = Depth in meters Lake = lake name, Michigan or Superior Nitrogen % Carbon % Date = mm/dd/yyyy pH = acidity, potential of Hydrogen (pH) scale SampleDescription = Sample or control X = sequential run number OTU ID = Operational taxonomic unit ID

This dataset was developed to create a census of sufficiently documented molecular biology databases to answer several preliminary research questions. Articles published in the annual Nucleic Acids Research (NAR) “Database Issues” were used to identify a population of databases for study. Namely, the questions addressed herein include: 1) what is the historical rate of database proliferation versus rate of database attrition?, 2) to what extent do citations indicate persistence?, and 3) are databases under active maintenance and does evidence of maintenance likewise correlate to citation? An overarching goal of this study is to provide the ability to identify subsets of databases for further analysis, both as presented within this study and through subsequent use of this openly released dataset.

This dataset presents a citation analysis and citation context analysis used in Linh Hoang, Frank Scannapieco, Linh Cao, Yingjun Guan, Yi-Yun Cheng, and Jodi Schneider. Evaluating an automatic data extraction tool based on the theory of diffusion of innovation. Under submission. We identified the papers that directly describe or evaluate RobotReviewer from the list of publications on the RobotReviewer website <http://www.robotreviewer.net/publications>, resulting in 6 papers grouped into 5 studies (we collapsed a conference and journal paper with the same title and authors into one study). We found 59 citing papers, combining results from Google Scholar on June 05, 2018 and from Scopus on June 23, 2018. We extracted the citation context around each citation to the RobotReviewer papers and categorized these quotes into emergent themes.

Data consists of RNA expression, tuber mass, photosynthetic capacity and diurnal CO2 assimilation calculations, potato tuber nutrient content, photorespiratory metabolite analysis and meteorological data to support the increase in yield and thermotolerance observed in potato plants with an introduce photorespiratory bypass. Data was collected between 2019-2024 at University of Illinois at Urbana-Champaign, IL, USA.

Datasets and R scripts relating to the manuscript "Ecological characteristics and in situ genetic associations for yield-component traits of wild Miscanthus from eastern Russia" published in Annals of Botany, 10.1093/aob/mcw137. Field data, including collection locations, physical and ecological information for each location, and plant phenotypes relating to biomass are included. Genetic data in this repository include single nucleotide polymorphisms (SNPs) derived from restriction site-associated DNA sequencing (RAD-seq), as well as plastid microsatellites. A file is also included listing the DNA sequences of all RAD-seq markers generated to-date by the Sacks lab, including those from this publication.

Indianapolis Int'l Airport to Urbana: Sampling Rate: 2 Hz Total Travel Time: 5901534 ms or 98.4 minutes Number of Data Points: 11805 Distance Traveled: 124 miles via I-74 Device used: Samsung Galaxy S6 Date Recorded: 2016-11-27 Parameters Recorded: * ACCELEROMETER X (m/s²) * ACCELEROMETER Y (m/s²) * ACCELEROMETER Z (m/s²) * GRAVITY X (m/s²) * GRAVITY Y (m/s²) * GRAVITY Z (m/s²) * LINEAR ACCELERATION X (m/s²) * LINEAR ACCELERATION Y (m/s²) * LINEAR ACCELERATION Z (m/s²) * GYROSCOPE X (rad/s) * GYROSCOPE Y (rad/s) * GYROSCOPE Z (rad/s) * LIGHT (lux) * MAGNETIC FIELD X (microT) * MAGNETIC FIELD Y (microT) * MAGNETIC FIELD Z (microT) * ORIENTATION Z (azimuth °) * ORIENTATION X (pitch °) * ORIENTATION Y (roll °) * PROXIMITY (i) * ATMOSPHERIC PRESSURE (hPa) * SOUND LEVEL (dB) * LOCATION Latitude * LOCATION Longitude * LOCATION Altitude (m) * LOCATION Altitude-google (m) * LOCATION Altitude-atmospheric pressure (m) * LOCATION Speed (kph) * LOCATION Accuracy (m) * LOCATION ORIENTATION (°) * Satellites in range * GPS NMEA * Time since start in ms * Current time in YYYY-MO-DD HH-MI-SS_SSS format Quality Notes: There are some things to note about the quality of this data set that you may want to consider while doing preprocessing. This dataset was taken continuously as a single trip, no stop was made for gas along the way making this a very long continuous dataset. It starts in the parking lot of the Indianapolis International Airport and continues directly towards a gas station on Lincoln Avenue in Urbana, IL. There are a couple parts of the trip where the phones orientation had to be changed because my navigation cut out. These times are easy to account for based on Orientation X/Y/Z change. I would also advise cutting out the first couple hundred points or the points leading up to highway speed. The phone was mounted in the cupholder in the front seat of the car.

Leesburg, VA to Indianapolis, Indiana: Sampling Rate: 0.1 Hz Total Travel Time: 31100007 ms or 518 minutes or 8.6 hours Distance Traveled: 570 miles via I-70 Number of Data Points: 3112 Device used: Samsung Galaxy S4 Date Recorded: 2017-01-15 Parameters Recorded: * ACCELEROMETER X (m/s²) * ACCELEROMETER Y (m/s²) * ACCELEROMETER Z (m/s²) * GRAVITY X (m/s²) * GRAVITY Y (m/s²) * GRAVITY Z (m/s²) * LINEAR ACCELERATION X (m/s²) * LINEAR ACCELERATION Y (m/s²) * LINEAR ACCELERATION Z (m/s²) * GYROSCOPE X (rad/s) * GYROSCOPE Y (rad/s) * GYROSCOPE Z (rad/s) * LIGHT (lux) * MAGNETIC FIELD X (microT) * MAGNETIC FIELD Y (microT) * MAGNETIC FIELD Z (microT) * ORIENTATION Z (azimuth °) * ORIENTATION X (pitch °) * ORIENTATION Y (roll °) * PROXIMITY (i) * ATMOSPHERIC PRESSURE (hPa) * Relative Humidity (%) * Temperature (F) * SOUND LEVEL (dB) * LOCATION Latitude * LOCATION Longitude * LOCATION Altitude (m) * LOCATION Altitude-google (m) * LOCATION Altitude-atmospheric pressure (m) * LOCATION Speed (kph) * LOCATION Accuracy (m) * LOCATION ORIENTATION (°) * Satellites in range * GPS NMEA * Time since start in ms * Current time in YYYY-MO-DD HH-MI-SS_SSS format Quality Notes: There are some things to note about the quality of this data set that you may want to consider while doing preprocessing. This dataset was taken continuously but had multiple stops to refuel (without the data recording ceasing). This can be removed by parsing out all data that has a speed of 0. The mount for this dataset was fairly stable (as can be seen by the consistent orientation angle throughout the dataset). It was mounted tightly between two seats in the back of the vehicle. Unfortunately, the frequency for this dataset was set fairly low at one per ten seconds.

This dataset contains: field study design parameters, plant performance metrics, and nitrogen cycling rates associated with a field experiment that compared nitrification rates between maize lines with and without nitrification inhibition loci nitrogen fixation rates with with and without a nitrogen fixing inoculant product. The overarching goal was to evaluate nitrogen fixation by a diazotroph inoculant and retention of nitrogen in the rhizosphere via a novel nitrification inhibition phenotype of maize.